ID: 951954992

View in Genome Browser
Species Human (GRCh38)
Location 3:28243700-28243722
Sequence CCCTAGGGTCCAGAACAATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 1, 2: 0, 3: 6, 4: 81}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951954992_951954996 -7 Left 951954992 3:28243700-28243722 CCATATTGTTCTGGACCCTAGGG 0: 1
1: 1
2: 0
3: 6
4: 81
Right 951954996 3:28243716-28243738 CCTAGGGAACAGTAGTACATAGG 0: 1
1: 0
2: 1
3: 3
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951954992 Original CRISPR CCCTAGGGTCCAGAACAATA TGG (reversed) Intronic