ID: 951954992

View in Genome Browser
Species Human (GRCh38)
Location 3:28243700-28243722
Sequence CCCTAGGGTCCAGAACAATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 1, 2: 0, 3: 6, 4: 81}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951954992_951954996 -7 Left 951954992 3:28243700-28243722 CCATATTGTTCTGGACCCTAGGG 0: 1
1: 1
2: 0
3: 6
4: 81
Right 951954996 3:28243716-28243738 CCTAGGGAACAGTAGTACATAGG 0: 1
1: 0
2: 1
3: 3
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951954992 Original CRISPR CCCTAGGGTCCAGAACAATA TGG (reversed) Intronic
900313003 1:2043508-2043530 CCCCAGGGTCCAGACCACTGGGG - Intergenic
901663809 1:10815276-10815298 CCCAAGGGCCCAGAAGAATTTGG - Intergenic
908415636 1:63910808-63910830 CCCAAAGGTTCAGAACAACAAGG + Intronic
911482203 1:98458315-98458337 TCCTAGGGGCAAGAAAAATAAGG + Intergenic
914747439 1:150510599-150510621 CCCCAGGGTCCTGAGCACTAAGG - Intronic
916739714 1:167637531-167637553 CCCTAGGGTGCAGAACACACAGG + Intronic
917442718 1:175081160-175081182 GCCTGGGGTACAGAACAAGATGG + Intronic
921377185 1:214486603-214486625 ACCCAGGGCCCAGAACAAAACGG + Intronic
1076278600 10:129225926-129225948 CCCAAGGCTCCAGCACAAGAAGG + Intergenic
1079250994 11:18787847-18787869 CCCTAGGGGCTAGAACAACCTGG + Intronic
1080024872 11:27602525-27602547 CCATATGGTCATGAACAATAAGG - Intergenic
1080391945 11:31856161-31856183 TCCCAGGCTCCAGAACCATAAGG + Intronic
1081048393 11:38305990-38306012 CCCTAGGTACCAGAAAAATGTGG + Intergenic
1085987588 11:81805691-81805713 CCCTAGGGTTAAGAACCCTAGGG + Intergenic
1088194537 11:107260385-107260407 CTCTAGTGTCCAGCACAATATGG - Intergenic
1088434175 11:109792498-109792520 GACCAGGGTCCAGATCAATAAGG + Intergenic
1089394517 11:118127300-118127322 CCATGGGGGCCGGAACAATAGGG + Intergenic
1090311411 11:125744464-125744486 CCATAGGGTTCAAAACAATAGGG + Intergenic
1095802277 12:46281513-46281535 CCCTAGGGCCCTGAACACTTAGG - Intergenic
1096784036 12:54007024-54007046 CCCTAGGGTCCAGAACAGTAGGG - Intronic
1098202199 12:68068259-68068281 CCCTAGGGTCAAAGAAAATAAGG - Intergenic
1108966120 13:56304356-56304378 CCCCAGGGTCCATAAAACTATGG - Intergenic
1111582929 13:90248815-90248837 CCCTAGGGACAATAACAAAAGGG + Intergenic
1112842310 13:103595412-103595434 CCATACGGTCCACAACAATTGGG - Intergenic
1121681362 14:95795251-95795273 CCGTAGGGTACAAAACAATTGGG - Intergenic
1130742753 15:86618856-86618878 CCAGAGGGTCCAGCAAAATAGGG - Intronic
1132384852 15:101393090-101393112 CCCTGGGATCCGGAACAATCTGG + Intronic
1133638270 16:7691291-7691313 CCCTAAGTTTCAGAACAAAAGGG - Intronic
1136691316 16:32032871-32032893 CCCTAGGGGCCAGGACACTGGGG - Intergenic
1136791904 16:32976436-32976458 CCCTAGGGGCCAGGACACTGGGG - Intergenic
1136877913 16:33877472-33877494 CCCTAGGGGCCAGGACACTGGGG + Intergenic
1137888868 16:52137160-52137182 CCCTAGAGTCAAGAATAATGTGG + Intergenic
1203094115 16_KI270728v1_random:1237900-1237922 CCCTAGGGGCCAGGACACTGGGG - Intergenic
1148785748 17:50145416-50145438 CCCTGGGCTCCAGAACTATAAGG - Intronic
1156580215 18:38366352-38366374 TCCTAGGGCACAGAGCAATATGG + Intergenic
1160847529 19:1173172-1173194 CCCCAGAGTCCCGAAGAATAAGG - Intronic
1160984934 19:1834098-1834120 CCCTGGGGTCCAGGACAAGGAGG - Intronic
1165162109 19:33822696-33822718 CACTAGAGTCCAGAAAAACAAGG - Intergenic
1168584047 19:57578556-57578578 CCCTAGAGTCCAGGACTATGAGG - Intronic
926953403 2:18268491-18268513 CCCTAAGGTCCAGGACAAGCTGG + Intronic
929886719 2:45885334-45885356 CCCTAGGGTCGATAAAAAAAAGG - Intronic
932499843 2:72173870-72173892 CCCTAGGGACCAGAAGACAAAGG - Intergenic
933335165 2:80949011-80949033 CACAAGAGTGCAGAACAATAGGG - Intergenic
941167064 2:162093876-162093898 CCCTAGGTTACAGAACAGTAGGG - Intergenic
945723135 2:213444091-213444113 CCCTAGGCTACAGAACAAAGAGG - Intronic
948992539 2:241562136-241562158 CCCTAGGGACCAGAAGACCAAGG - Intronic
1173597990 20:44272141-44272163 TCCTGGGGTGCAGAACAACATGG + Intronic
1175677338 20:60958078-60958100 GCCCAGGGACCAGCACAATAGGG - Intergenic
1177736137 21:25092616-25092638 CCCTAGGGGCCACCACAATGGGG - Intergenic
1178687194 21:34721125-34721147 CCATGGGAGCCAGAACAATAGGG - Intergenic
1182567824 22:31212845-31212867 CTCTAGGGTTCAGGACAATTAGG + Intronic
1183489543 22:38109199-38109221 CCCTGGGGTCCAGAGCATCATGG - Exonic
1183671267 22:39274250-39274272 CTGTAGGGTGCAGAACAAGAGGG + Intergenic
951263061 3:20534492-20534514 TCCTAGGTCCCAGTACAATAGGG - Intergenic
951954992 3:28243700-28243722 CCCTAGGGTCCAGAACAATATGG - Intronic
953776169 3:45819310-45819332 CCCAAGGGTTCAGAAGAATCTGG - Intergenic
954514750 3:51163524-51163546 CCTTCGGGTCAAGAAAAATATGG - Intronic
957198471 3:77101381-77101403 CTCTAGGGAACAGAACAGTATGG + Intronic
958419437 3:93914167-93914189 CCCGAGAGCCCAGAACTATAGGG - Intronic
964221030 3:154344981-154345003 CCCCAGTGTCCAGAAAAAGATGG - Intronic
968673223 4:1863525-1863547 TCCTAGGCTCCAGAACGATGAGG + Intergenic
969363986 4:6683206-6683228 CCAAAGGGACCAGAACAAGAGGG + Intergenic
969491958 4:7504582-7504604 CCCTGGGGTCCAGAGCCAGATGG - Intronic
971740505 4:30514384-30514406 CCACAGGGTCCAGAACAGGAAGG - Intergenic
982293568 4:153804258-153804280 TCCCAGCCTCCAGAACAATAAGG - Intergenic
983257440 4:165416376-165416398 CCCTAGGGGCCAGAGCATTAAGG - Intronic
984370246 4:178855037-178855059 CCCAAGGTTGCAGAGCAATAAGG + Intergenic
984646639 4:182227294-182227316 CTCCAGGGTCCAGGACAATGTGG - Intronic
988114408 5:26866317-26866339 CCCCAGAGTCCCGAAAAATAAGG - Intergenic
994810530 5:104512615-104512637 CACTAAGGTCTAGAACAACACGG - Intergenic
1001738423 5:174027603-174027625 CCCTAGGGTTCAGAAGGAGAGGG + Intergenic
1002636899 5:180613075-180613097 CCCTGGGGTGCAGATCAATGAGG - Exonic
1002776944 6:336415-336437 ACCTAGGGTCCTGAACATTGGGG - Intronic
1003215211 6:4103207-4103229 CCCTAGAGTCCATATAAATATGG - Intronic
1005237777 6:23785801-23785823 GTCTAGGATCCAGAAGAATAGGG + Intergenic
1005422936 6:25671779-25671801 GCCTGGGGTACAGAACAATAAGG + Intronic
1017806746 6:157952980-157953002 CCCTGGGCTCCAGAACAGGAAGG - Intergenic
1020262013 7:6536110-6536132 CCCTAGAGGCCAGCACACTATGG + Intronic
1022262347 7:28718676-28718698 CCCCAGTGTCCAGAACAGCAGGG - Intronic
1028801837 7:94975008-94975030 CCTAAGGGTCCTGAAAAATATGG - Intronic
1030565894 7:111155133-111155155 CCCTAGGATCAAGATGAATATGG + Intronic
1033546006 7:142400671-142400693 CCTTAGGGTAGAGAAGAATATGG - Intergenic
1037558667 8:20052850-20052872 CCCTAGGAACAAGAAAAATAAGG - Intergenic
1038526305 8:28276641-28276663 CCCCAGGGTCCAGGACAAGGGGG - Intergenic
1041422129 8:57679448-57679470 CTCTAAGATACAGAACAATAAGG - Intergenic
1044479194 8:92665518-92665540 CCCTAAGATGCAGAAAAATAAGG - Intergenic
1047692335 8:127368546-127368568 CCTTGGTGCCCAGAACAATAAGG - Intergenic
1053383166 9:37665814-37665836 TGCTGGGGTCCAGAACCATAAGG - Intronic
1199894384 X:152117207-152117229 CCTTTGAGTCCAGAACAATGGGG - Intergenic