ID: 951954996

View in Genome Browser
Species Human (GRCh38)
Location 3:28243716-28243738
Sequence CCTAGGGAACAGTAGTACAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 74}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951954990_951954996 -6 Left 951954990 3:28243699-28243721 CCCATATTGTTCTGGACCCTAGG 0: 1
1: 0
2: 1
3: 6
4: 68
Right 951954996 3:28243716-28243738 CCTAGGGAACAGTAGTACATAGG 0: 1
1: 0
2: 1
3: 3
4: 74
951954992_951954996 -7 Left 951954992 3:28243700-28243722 CCATATTGTTCTGGACCCTAGGG 0: 1
1: 1
2: 0
3: 6
4: 81
Right 951954996 3:28243716-28243738 CCTAGGGAACAGTAGTACATAGG 0: 1
1: 0
2: 1
3: 3
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951954996 Original CRISPR CCTAGGGAACAGTAGTACAT AGG Intronic
902838972 1:19063460-19063482 CCCAGGGAACAAGAGGACATTGG - Intergenic
909887903 1:80965450-80965472 CCTAAGAAACAGTGGTAAATAGG + Intergenic
918134330 1:181658313-181658335 CATGGGAAACAGTTGTACATTGG + Intronic
921818169 1:219587287-219587309 CCTTGGGAAGAGTAGGCCATGGG - Intergenic
923327624 1:232894865-232894887 CCAATGGAACAGTAGAAAATGGG - Intergenic
924748271 1:246859361-246859383 CCAGGGGAACACTAGTAAATGGG - Intronic
1066214340 10:33271765-33271787 CCTAGGGGACACTAGTGTATTGG - Intronic
1073034423 10:100553284-100553306 CTTAGGGATCAGTAGTTCAGGGG + Exonic
1082842333 11:57699670-57699692 ACTAGAGAGTAGTAGTACATAGG + Intronic
1085468822 11:76743715-76743737 CCAAGCAAACATTAGTACATCGG - Intergenic
1086753791 11:90532879-90532901 CCTTAGGAAGAGGAGTACATTGG - Intergenic
1087607660 11:100395876-100395898 CCTAGGGAACTGAGGTACCTAGG - Intergenic
1088440794 11:109867811-109867833 CCAAGGGGACAGAAGTCCATTGG - Intergenic
1095564233 12:43602229-43602251 CCTAGGGACCATTACTACAGAGG + Intergenic
1096048587 12:48586406-48586428 CCTAGGGAACAGGAAGAGATAGG + Intergenic
1100803240 12:98255004-98255026 CCAAGGGAATAGGAATACATTGG + Intergenic
1109442004 13:62386600-62386622 CATAGGAAACAGTAATACAAAGG + Intergenic
1122854690 14:104554442-104554464 CTTAGGGAACAGCAGGACAGAGG - Intronic
1126190244 15:45871402-45871424 CCCAGGGAACAGAACTCCATTGG + Intergenic
1129004552 15:72361355-72361377 CCTGGGTAACATTAGTACATTGG - Intronic
1132196025 15:99915459-99915481 CCCAGGGAATAGCAGGACATTGG + Intergenic
1134395010 16:13854603-13854625 CCTAGGGGACTGTATTACAATGG - Intergenic
1143393295 17:6573098-6573120 CCTGGGGAACAGCACTGCATGGG + Intergenic
1156873239 18:41973231-41973253 CCTAGGGTAAAGTGTTACATAGG + Intronic
1156951255 18:42901252-42901274 CCAAGGCAACAATTGTACATTGG - Intronic
1162990136 19:14296617-14296639 CATTGGGAGCAGTAGTAGATTGG - Intergenic
1164439693 19:28264233-28264255 CTTAAGGAACAGTATGACATGGG + Intergenic
926292428 2:11541506-11541528 CATAGAGAAGAGTAGTGCATGGG - Intronic
927374834 2:22401733-22401755 CCAAGGGTACAGTACTACCTGGG + Intergenic
931431758 2:62214185-62214207 CTGAGGGAACAGTAGCATATTGG + Intronic
932529413 2:72512020-72512042 CCTAAAGAACAGTAGTGCAAGGG - Intronic
935571908 2:104670841-104670863 GCTGGGGTACAGTAGTACAGTGG + Intergenic
948070480 2:235117788-235117810 CCTGGGGATCAGTTTTACATGGG + Intergenic
948469707 2:238169134-238169156 TCTCGGGAACAGTGGGACATAGG + Intergenic
1171002409 20:21427965-21427987 CCTAGGGAATAGGAATAGATGGG + Intergenic
1179644640 21:42767895-42767917 CCTAGGGAACAGCAGAAAATAGG + Intronic
951954996 3:28243716-28243738 CCTAGGGAACAGTAGTACATAGG + Intronic
952838866 3:37627646-37627668 CCTAGGGAACTGAGGTTCATAGG + Intronic
955982349 3:64539744-64539766 CCTAGGCAACAGGAGGACAGAGG - Intronic
958804282 3:98790884-98790906 CCTAGGTTACAATGGTACATAGG + Intronic
965754406 3:172010837-172010859 CCTAGGGAAGTGTAGTACATTGG - Intergenic
967105757 3:186253821-186253843 ACTAGGGAATAGTGGGACATTGG + Intronic
967279708 3:187810069-187810091 CCCAGGGAATAGCAGTACTTGGG + Intergenic
969137376 4:5040891-5040913 CCTAGGCAACTGTAACACATTGG + Intergenic
970505995 4:16731096-16731118 CCTAGGGAAAGGATGTACATAGG + Intronic
978008295 4:103646902-103646924 CTTAGGGAACAGTATGATATAGG + Intronic
978775539 4:112502856-112502878 CTAAGGGAACACTAGTTCATAGG + Intergenic
979083497 4:116374565-116374587 CAAGGGGAACAATAGTACATTGG - Intergenic
979670309 4:123354394-123354416 CCTAGGTAACAGCAGTGCATAGG + Intergenic
985695307 5:1336831-1336853 CTGAGGGAACAGCAGTACAGGGG + Intronic
986470396 5:8067972-8067994 CATAGGGCACAGTTGCACATGGG + Intergenic
986728038 5:10614353-10614375 GCTAGGCCACAGTAGTACCTAGG - Intronic
987436903 5:17905937-17905959 CCTTGGGAACATAAGTCCATTGG - Intergenic
992889736 5:81193167-81193189 CCAAGGGAACTCTAGGACATTGG - Intronic
993018303 5:82562269-82562291 TCTGGGGGTCAGTAGTACATCGG + Intergenic
995663436 5:114512442-114512464 CTTAGGCAACAGTAGAAAATAGG + Intergenic
1003356058 6:5371574-5371596 TCTAGTGAACAGTAATAAATTGG + Intronic
1006819919 6:36884936-36884958 ACTAGGAAACAGTAGAACAGTGG - Intronic
1009048866 6:58256777-58256799 TATAGGGAACAATATTACATAGG + Intergenic
1009868585 6:69428826-69428848 TCTAGGGAACAGCAATATATGGG - Intergenic
1009910121 6:69915786-69915808 CCTAATGAAAAGTAATACATTGG - Intronic
1015027990 6:128560315-128560337 TCTACGGAACAGTAGTAAACCGG - Intergenic
1022882185 7:34599559-34599581 CCTAGGACATATTAGTACATGGG - Intergenic
1024146353 7:46521646-46521668 CCTAAGGAAGAGCAGTAAATGGG + Intergenic
1029426247 7:100495799-100495821 TCTATGGAACAGTAGGAGATGGG + Intergenic
1030057626 7:105597298-105597320 CCCAGGGAACAGAAGGGCATGGG - Intronic
1041923511 8:63210964-63210986 CTTTTGGAACAGTAATACATGGG - Intronic
1042704881 8:71655449-71655471 CCTAAGGAGCAGTCCTACATGGG + Intergenic
1043601274 8:81941226-81941248 CCTAGGGTACAGGAGTAAGTAGG + Intergenic
1051215810 9:14796141-14796163 CATAGGGAACAGCAGGATATGGG + Intronic
1053531466 9:38886477-38886499 CCTAGGATAAAGTAGTACACAGG - Intergenic
1054203690 9:62110905-62110927 CCTAGGATAAAGTAGTACACAGG - Intergenic
1054634672 9:67477459-67477481 CCTAGGATAAAGTAGTACACAGG + Intergenic
1056120071 9:83478951-83478973 TCTAGGGACCCGTAGTGCATAGG - Intronic
1059619041 9:115983315-115983337 CCTAAGTAACAGTAGAACTTTGG + Intergenic
1062189515 9:135240633-135240655 CCTTGGGAATAGTCGGACATTGG - Intergenic
1192373946 X:70539930-70539952 CCAAGGGACCAGTAGTAAAAAGG + Intronic
1195289279 X:103415835-103415857 TCTAGGGAACTGTAGCACAAAGG + Intergenic
1195450497 X:105006716-105006738 TCTTGGAAACAGTAGTTCATAGG - Intronic