ID: 951954996

View in Genome Browser
Species Human (GRCh38)
Location 3:28243716-28243738
Sequence CCTAGGGAACAGTAGTACAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 74}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951954990_951954996 -6 Left 951954990 3:28243699-28243721 CCCATATTGTTCTGGACCCTAGG 0: 1
1: 0
2: 1
3: 6
4: 68
Right 951954996 3:28243716-28243738 CCTAGGGAACAGTAGTACATAGG 0: 1
1: 0
2: 1
3: 3
4: 74
951954992_951954996 -7 Left 951954992 3:28243700-28243722 CCATATTGTTCTGGACCCTAGGG 0: 1
1: 1
2: 0
3: 6
4: 81
Right 951954996 3:28243716-28243738 CCTAGGGAACAGTAGTACATAGG 0: 1
1: 0
2: 1
3: 3
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951954996 Original CRISPR CCTAGGGAACAGTAGTACAT AGG Intronic