ID: 951955577

View in Genome Browser
Species Human (GRCh38)
Location 3:28249683-28249705
Sequence CAGCCAGGGTTGAGAGCTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 512
Summary {0: 1, 1: 0, 2: 9, 3: 98, 4: 404}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951955573_951955577 0 Left 951955573 3:28249660-28249682 CCCTCTCAGGTGGTTCTTGGGTA 0: 1
1: 0
2: 3
3: 18
4: 158
Right 951955577 3:28249683-28249705 CAGCCAGGGTTGAGAGCTTCTGG 0: 1
1: 0
2: 9
3: 98
4: 404
951955568_951955577 24 Left 951955568 3:28249636-28249658 CCAAGCATTAAGAATTTTGTACA 0: 1
1: 0
2: 1
3: 15
4: 241
Right 951955577 3:28249683-28249705 CAGCCAGGGTTGAGAGCTTCTGG 0: 1
1: 0
2: 9
3: 98
4: 404
951955574_951955577 -1 Left 951955574 3:28249661-28249683 CCTCTCAGGTGGTTCTTGGGTAC 0: 1
1: 0
2: 0
3: 15
4: 79
Right 951955577 3:28249683-28249705 CAGCCAGGGTTGAGAGCTTCTGG 0: 1
1: 0
2: 9
3: 98
4: 404
951955567_951955577 25 Left 951955567 3:28249635-28249657 CCCAAGCATTAAGAATTTTGTAC 0: 1
1: 0
2: 0
3: 12
4: 228
Right 951955577 3:28249683-28249705 CAGCCAGGGTTGAGAGCTTCTGG 0: 1
1: 0
2: 9
3: 98
4: 404

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951955577 Original CRISPR CAGCCAGGGTTGAGAGCTTC TGG Intronic
900371509 1:2334208-2334230 CAGCCACAGTTGAGGGCCTCTGG + Intronic
900475095 1:2872370-2872392 CAGCCAGGGGTGACAGCGTGTGG + Intergenic
901128984 1:6950377-6950399 CATCCAGAGCTGAGAGCTTTGGG + Intronic
902858063 1:19223645-19223667 CTGCCAGGCTGGAGAGCTCCAGG - Intronic
902861790 1:19251916-19251938 CAGCCTGCGGTGAGGGCTTCGGG + Intronic
903000073 1:20258885-20258907 CAGCCAGCGTTGAGAACTGGTGG + Intergenic
903490228 1:23722778-23722800 TAGCCAGGGTTGAGAGTACCAGG + Intergenic
905645040 1:39619390-39619412 CAGCCAGCTTTCTGAGCTTCAGG + Intergenic
906059873 1:42941579-42941601 CAGCCAAGGTTGACAGCTACTGG - Intronic
906136474 1:43503440-43503462 CAGCCAGGGAAGTGAGCATCTGG - Intergenic
906382823 1:45343554-45343576 GAGCCAGGGTCCAGAGCTGCAGG - Exonic
906524929 1:46488414-46488436 CAGCCTGGGTTGAGGGCGTCAGG - Intergenic
907457169 1:54583161-54583183 CAGCCAGGGTGGAGGCCTGCAGG - Intronic
908766963 1:67562929-67562951 TAGCTAGGGTTGAGAGCTTTTGG - Intergenic
908986907 1:70035295-70035317 CAGGCAGGGTGGAGAGCATTAGG - Intronic
910412951 1:86965522-86965544 CAGCCAGGCTTGAGAACCACTGG - Intronic
910550889 1:88473455-88473477 CAGCTGGAGTTGTGAGCTTCTGG + Intergenic
910630412 1:89347724-89347746 CAGCCAGGATTGATAGGTCCAGG + Intergenic
912163221 1:107011600-107011622 CACCCCTGGTTGAGAGCTACTGG - Intergenic
912649771 1:111427376-111427398 CAGCCAGGGTTCAGAACCACTGG - Intronic
915181447 1:154064550-154064572 CAGGAAGACTTGAGAGCTTCAGG - Intronic
915301556 1:154954419-154954441 CAGCCAGGGTTAAGAGCCACTGG + Intronic
915970009 1:160348058-160348080 CAGCCAGGGCTGAGAACTACTGG + Intronic
916028748 1:160858414-160858436 CAGCCTGAGTTGAGATCTGCTGG - Intronic
916509379 1:165457779-165457801 CAGCCAGCTATGAGAGCTTTGGG + Intergenic
916678769 1:167085992-167086014 CAACCAGGGTTGAGAGCCACTGG + Intronic
917409097 1:174739643-174739665 CAGCCATGGTTGAGAGCCAATGG + Intronic
918008542 1:180564768-180564790 CAGCCAGGGGTGAGAACCACTGG - Intergenic
918070995 1:181133299-181133321 CAGCCAGGGTTGAGACCTACTGG - Intergenic
918163094 1:181919454-181919476 CAGCCAGGGAAGAGACTTTCCGG + Intergenic
918464471 1:184807426-184807448 CAGCCAGGATTGAGAGCCACTGG - Intronic
920054645 1:203183292-203183314 CAGGCAGAGCTGAGAGCTGCTGG + Intronic
920561620 1:206942808-206942830 AAGCCAGGGATGAGAGCATCAGG + Intronic
922377249 1:224980703-224980725 CAGCCAGGCTTGTGTCCTTCTGG - Intronic
922965754 1:229689523-229689545 CAGGCAGGGTTGAGAGGTGCTGG - Intergenic
923616047 1:235538380-235538402 CACCTAGGGCTGTGAGCTTCAGG + Intergenic
923771285 1:236939790-236939812 CAGCCATTATTGAGAGCTTTTGG - Intergenic
924518548 1:244786237-244786259 CAGCCAGGGCTGACAGCCACAGG - Intergenic
1063284578 10:4671651-4671673 GAGCCAGAGGTGAGAGCTTATGG + Intergenic
1064377655 10:14811251-14811273 CAGCCCAGGTTGAGAGCCACTGG + Intergenic
1066421082 10:35265567-35265589 CAGCCAGCGTTGAGAGCTGGGGG + Intronic
1067381094 10:45774197-45774219 GGCCCAGGGCTGAGAGCTTCTGG - Intronic
1067888791 10:50114826-50114848 GGCCCAGGGCTGAGAGCTTCTGG - Intronic
1069359044 10:67621226-67621248 CAGCCAGGGTTGAAAACCACTGG + Intronic
1069428934 10:68315700-68315722 CAGTCAGAGGTGAGAGCTTAGGG - Intronic
1069526060 10:69173221-69173243 CAGCCAGGGTTGAGAACCAATGG - Intergenic
1069638524 10:69940479-69940501 CACCCAGGGCTGAGACCCTCAGG + Intronic
1069688024 10:70331607-70331629 CAGAGAGGGCTGAGATCTTCTGG + Intronic
1069833831 10:71296486-71296508 CAGGGAGGGTTGGGAGCTTTGGG - Intronic
1070840522 10:79484213-79484235 CAGCCAGGGTTTGGGGCCTCGGG + Intergenic
1070873017 10:79774546-79774568 CAGCCAAGGTTGAGAACCACTGG - Intergenic
1071639943 10:87296697-87296719 CAGCCAAGGTTGAGAACCACTGG - Intergenic
1071655291 10:87441252-87441274 CAGCCAAGGTTGAGAACCACTGG + Intergenic
1071846759 10:89528717-89528739 CAGCCAGGGTTGAGAAACTATGG - Intronic
1072443401 10:95477280-95477302 CTGCCAGGGTTGAGTTCTCCAGG - Intronic
1072802083 10:98399202-98399224 CAGCCAGGTTTGAAAACTGCTGG + Intronic
1073028127 10:100503270-100503292 CAGCCAATGTTGAGAACTGCTGG - Intronic
1073093664 10:100967025-100967047 CAGCCAGGGTAGTGACCTTATGG + Intergenic
1073788011 10:106911679-106911701 CAACCAGGGTTGAGAACCACTGG - Intronic
1074711625 10:116182866-116182888 CAGCCAGAGCTGAGCGCTCCTGG + Intronic
1075468947 10:122673459-122673481 CAGCCAGCGGTGGGAGCTGCTGG - Intergenic
1075602368 10:123779478-123779500 CAGCCAGGTTTCAGAACTACTGG - Intronic
1075649466 10:124118248-124118270 CAGCCAGGGTGGAGGGCCACAGG - Intergenic
1075856889 10:125637613-125637635 CAGCCAGGGCTGACAACTGCTGG - Intronic
1076980163 11:199876-199898 CAGCCAGGGCAGAGACCTGCAGG + Intronic
1077169827 11:1161131-1161153 CAGCCAGGGCAGGGGGCTTCAGG + Intronic
1077439737 11:2562280-2562302 CAGCCTGTGCTGAGAGCTTGTGG - Intronic
1078332718 11:10439090-10439112 CAGCAAAGCTGGAGAGCTTCGGG - Intronic
1078605562 11:12772012-12772034 CAGCCAGGTTTGAGAGCTGCTGG + Intronic
1079112877 11:17614978-17615000 CAGCAATGGATGAGAGCTCCAGG + Intronic
1079340083 11:19604504-19604526 CAGCTAGGATTGAGAGTTTGGGG + Intronic
1079583758 11:22098937-22098959 CAGCCAGAATTGAGAGTTTAGGG - Intergenic
1079976328 11:27096072-27096094 CAGCCAAGGTTGAGAACCTCTGG + Intronic
1082682360 11:56191093-56191115 CAGCCAGAGTTGAAATCTTAGGG - Intergenic
1083501976 11:63117486-63117508 CATCCAGAGGTGAGAGCTTAGGG + Intronic
1086376994 11:86211180-86211202 CAGCCAGGGTTAAGAACTACGGG + Intergenic
1086641291 11:89159859-89159881 CAGCTAGGGTTTACAGTTTCTGG + Intergenic
1087714653 11:101594387-101594409 CAGGCAGGGCTGAGAGATGCTGG + Intronic
1087934234 11:104013454-104013476 CAGGCTGGGTTGAGTGCTTTTGG - Intronic
1088357407 11:108958385-108958407 CAGCCAGGGCTGAGAACTGCTGG + Intergenic
1088363005 11:109010845-109010867 CAGCCAGGGTAGAGATCTGCTGG - Intergenic
1089400643 11:118162477-118162499 CAGTCAGCCTTGGGAGCTTCCGG + Exonic
1090090404 11:123691900-123691922 CAGCCAGAGTTGAGAACTACTGG - Intergenic
1090393389 11:126403930-126403952 CAGCCAAGGTTGAGAACCACTGG - Intronic
1091201922 11:133787738-133787760 CAGCCAGGGTTGACAGCCACTGG + Intergenic
1091402393 12:188951-188973 CAGCCAGGGCAGAGAGCTTGCGG + Intergenic
1091437557 12:484582-484604 CAGTCAAGGTAGAGAGCCTCAGG + Intronic
1091638621 12:2216759-2216781 CAGCCAGGGTTGAGAACCACTGG + Intronic
1092954308 12:13535355-13535377 CAGCCAGAGTTGAAAACCTCTGG + Intergenic
1095179389 12:39129809-39129831 CAGCCAGAGTTGAGAACTAATGG + Intergenic
1095709207 12:45270118-45270140 CAGCCAGGGCTGAGAACCACTGG - Intronic
1095947831 12:47763815-47763837 CAGTCAGGGCTGGGAGCTGCAGG + Intronic
1096908908 12:54962602-54962624 CAGCCAAGGATGAGACTTTCTGG - Exonic
1097684235 12:62676941-62676963 CAGCCTGGAGTGAGAGCTTATGG + Intronic
1098270084 12:68761639-68761661 CACCCATGGTTGAGAACTACTGG + Intronic
1098554779 12:71805790-71805812 CAACCAGGGTTGAGAACCACTGG + Intergenic
1098955168 12:76681909-76681931 CAGCCAGGGTTGAAAACCTGTGG - Intergenic
1099743778 12:86675561-86675583 CAGCCAGAGTTGAGAACCACTGG - Intronic
1100533301 12:95480482-95480504 TAGCAATGGTTGAGAGTTTCAGG + Intronic
1102441260 12:112965438-112965460 CAGACAGGCTTGGGAGCTGCAGG + Intronic
1102810310 12:115818679-115818701 AAGCCAGAGTCGAGAGCTGCAGG + Intergenic
1103379027 12:120479553-120479575 CAGCCTGGGTTAAGAGCTGCAGG - Intronic
1104030124 12:125058947-125058969 CAGCCAGGGCTCAGACCTTGAGG - Intergenic
1104970273 12:132527784-132527806 CGGGCAGGGTTGAGGGCTTCGGG + Intronic
1105898113 13:24734914-24734936 CAGCCAGAGGTGAGAACTACTGG + Intergenic
1106281410 13:28276072-28276094 CAGCCAGGATTGAGAACCACTGG - Intronic
1107105319 13:36636731-36636753 GAGCTGGGGTTGAGAGCTTGGGG + Intergenic
1107808151 13:44174285-44174307 CAGCCAGGCTTGTGTCCTTCAGG + Intergenic
1108077879 13:46700532-46700554 CAGCCAGGGTTGAAAGCACTAGG - Intronic
1110246283 13:73327832-73327854 CAGCCAGGGGTGAGTGCCACTGG + Intergenic
1110624810 13:77641520-77641542 CAGCCAGGGTTGAGATCCACTGG - Intronic
1111359076 13:87150278-87150300 CACACAGGGCTGTGAGCTTCTGG - Intergenic
1111576811 13:90164978-90165000 CAGCCAGGGTTCTGAGTCTCAGG - Intergenic
1111615448 13:90656762-90656784 AAACCAGGGTTGAGAAATTCAGG + Intergenic
1111857104 13:93651952-93651974 CAGCCAGGGCTGAGAACCACTGG + Intronic
1111923883 13:94442162-94442184 CAGCCAGGCTTGAAAGACTCAGG + Intronic
1112385194 13:98932613-98932635 CAGCCTAGGTGGAGAACTTCAGG + Intronic
1113267875 13:108639543-108639565 CATTCAGGGTTGAGACATTCAGG - Intronic
1113458244 13:110464204-110464226 CAGCCAGGCTTGGGAGCCGCAGG - Intronic
1114301897 14:21385815-21385837 CATCCAGGCTTGAGAGCCCCTGG - Exonic
1115082477 14:29473550-29473572 CAGCCAGAGATGAGAGGTTAGGG + Intergenic
1115573411 14:34688279-34688301 CAGCCAGGGTTCAGAATGTCTGG + Intergenic
1116317236 14:43413539-43413561 CAACCAGAGTTGAGAGATTAGGG - Intergenic
1117332487 14:54726802-54726824 CAGCCAAGGTTGAGAACCACCGG + Intronic
1118149715 14:63176828-63176850 CATCCAGGGTTGAAAGTTCCAGG - Intergenic
1118352155 14:64979982-64980004 CAGCCAGGCTTGAGAGTCACTGG + Intronic
1118916589 14:70112555-70112577 GAGCCAAGGTTGAGGGCTTCTGG + Intronic
1119521568 14:75289839-75289861 GTGGCAGGGTAGAGAGCTTCTGG + Intergenic
1120353419 14:83394373-83394395 CAGCTAGAGGTGAGAGCTTTGGG - Intergenic
1120412483 14:84175160-84175182 CACCTAGGGCTGTGAGCTTCAGG - Intergenic
1120713034 14:87812807-87812829 CAGCCAAGGTTGAGAACAACGGG - Intergenic
1121172877 14:91869084-91869106 CAGCCAGGGTTGAAGGCCACTGG + Intergenic
1121416164 14:93780565-93780587 CAGCCAGGGCTGGGAACTGCTGG - Intronic
1121567482 14:94921555-94921577 CAGCCAGGCTTGAGAACCACTGG - Intergenic
1121567508 14:94921716-94921738 TGGCCAGGGTTGAGAGCCGCTGG + Intergenic
1121653206 14:95575315-95575337 CAGTCAGGGTTGAGAACCGCTGG + Intergenic
1122795732 14:104205280-104205302 CATCCTGGGGTGAGGGCTTCGGG + Intergenic
1124015363 15:25869319-25869341 CAGCCAGGTTTAAGAACCTCTGG + Intergenic
1126751630 15:51883629-51883651 CAGCCAAGGTTGACAGCAACTGG - Intronic
1126979623 15:54227282-54227304 CAGCCAGGAGTGAGAACTTATGG - Intronic
1127296146 15:57610418-57610440 CTGCCATGATTCAGAGCTTCAGG + Intronic
1127499302 15:59541797-59541819 CAACCAGGGCTGAGAGCACCTGG + Intergenic
1128167114 15:65475444-65475466 GAGCCAGGGTCCAGAGCTGCAGG + Intronic
1128512138 15:68319793-68319815 CAGCCAGGGCTGAGAACCACCGG - Intronic
1128612079 15:69082034-69082056 CAACCAGGGTTGAGAACTGAGGG + Intergenic
1129156061 15:73718878-73718900 CAGCCAGGGTTGAGAACCGCTGG - Intergenic
1130131896 15:81150619-81150641 CAGTCTGGGTTGAGAACCTCTGG + Intergenic
1130163926 15:81433304-81433326 CAGCCAGGTGTGAGAGCTTAAGG + Intergenic
1130973372 15:88753105-88753127 CAGCCAGTGTTGAGAACAGCTGG - Intergenic
1131343486 15:91625003-91625025 CAGCCAGATTTGAGAGCCGCTGG + Intergenic
1132850844 16:2024240-2024262 GGACCAGGGCTGAGAGCTTCCGG + Intergenic
1133233074 16:4375405-4375427 CAGCCAGGGTTCAGAACACCAGG - Intronic
1133653018 16:7830834-7830856 CACCTAGGGCTGTGAGCTTCAGG - Intergenic
1134008677 16:10835231-10835253 CAGCCAGGGTGGAGAACCACTGG + Intergenic
1134220585 16:12350741-12350763 CAGTCAGAGTTGAGAGCCACTGG - Intronic
1134328566 16:13229496-13229518 CAGCCAGGGTTGAGAACCACAGG - Intronic
1134816765 16:17212254-17212276 CAGCCAGGGTTAAGAACCACTGG - Intronic
1134871521 16:17656306-17656328 CAGCTGGAGTTGAGAGCCTCAGG - Intergenic
1135199048 16:20420797-20420819 CAGCCAGGGATGAGAGCCCGTGG + Intronic
1135219646 16:20602880-20602902 CAGCCAGGGATGAGAGCCCGTGG - Intergenic
1135450012 16:22549586-22549608 CAGCCAGGGTTGAGAACTGCTGG + Intergenic
1135967628 16:27049055-27049077 CAGCCAGGGTTGAGAGCCACTGG - Intergenic
1137504686 16:49043770-49043792 CAGCCAGAGGTGAGATCTTAGGG + Intergenic
1138296962 16:55895053-55895075 CAGCCAGATGTGAGAGCTTAGGG - Intronic
1139374245 16:66486940-66486962 CAGCCAGGCCTGAGGGCTCCAGG + Intronic
1140793328 16:78412734-78412756 CAGGCAGTTTTGAGAGGTTCTGG + Intronic
1141256620 16:82408471-82408493 CAGCCAGGGCTGAGAGCCCCTGG - Intergenic
1142666800 17:1467963-1467985 CAGCCAGGGTCCAGGGCTGCAGG - Intronic
1143503974 17:7353819-7353841 CAGCACAGGTTGAGACCTTCTGG - Exonic
1143946655 17:10598589-10598611 GACCCCAGGTTGAGAGCTTCTGG + Intergenic
1143974258 17:10818550-10818572 CAGGCAGGGTTGTGTCCTTCTGG - Intergenic
1144058626 17:11562004-11562026 CAGGCTGGGTTGGGAGCTTCAGG - Exonic
1144160019 17:12548733-12548755 CAGCCTGGGCTGAGAACTGCTGG - Intergenic
1144173356 17:12681340-12681362 CTGCCAGGTTTGTGAGCTTGAGG - Intronic
1144450280 17:15371604-15371626 CAGCCAGTCTTGAGAACTTGGGG - Intergenic
1144494784 17:15739219-15739241 CAGCCATGGATGAGAGTTTCCGG - Intronic
1144707283 17:17377987-17378009 CAGCCAGGGGTGAGACCCTAAGG - Intergenic
1144905469 17:18637453-18637475 CAGCCATGGATGAGAGTTTCCGG + Intronic
1146282674 17:31555174-31555196 CAGCCTGGGTAGGGAGCCTCAGG + Intergenic
1146630959 17:34468994-34469016 CAGAGCGGGTTGAGACCTTCAGG - Intergenic
1147900821 17:43782851-43782873 AAACCAGGATTGAGAACTTCTGG - Intronic
1148105224 17:45115208-45115230 CAGCCAGGGCCGACAGCTCCGGG + Exonic
1150106714 17:62467689-62467711 CAGCCAGGGGTGAGAGGTGCAGG + Intronic
1150337739 17:64342648-64342670 CAGACAGGGCTGAGATCCTCTGG + Intronic
1151016630 17:70561654-70561676 TAGCCAAGGATGAGATCTTCTGG + Intergenic
1151112533 17:71696139-71696161 AAGCCAGAGTAGAGAGATTCAGG + Intergenic
1151179825 17:72319166-72319188 CAGCCCAGTTTGAGAGCTACTGG - Intergenic
1151265742 17:72953695-72953717 CAGCAAGGTTTGAGGGCTGCAGG - Intronic
1151788964 17:76291773-76291795 CAGCCAGGCTTGATAGCACCAGG - Exonic
1152331459 17:79675575-79675597 CAGCCAGGGCTGAGGTCTTCAGG + Intergenic
1152489397 17:80619594-80619616 AATCCAGCGTTCAGAGCTTCTGG - Intronic
1153967423 18:10194655-10194677 CAGTCTGGGTTGAGATCCTCTGG - Intergenic
1154411426 18:14144159-14144181 CAGACAAGGCTGAGAGCTCCAGG - Intergenic
1155481053 18:26288053-26288075 CAGCCAGGTTTGAGAACCACTGG + Intronic
1157617980 18:48998639-48998661 CAGCCAAGGTTGAGAGCCAAGGG + Intergenic
1158490886 18:57908761-57908783 CAGCCAGGGTTGAGAACTCCAGG - Intergenic
1158949556 18:62480487-62480509 CAGCCAGAGGTGAGAGCTAAGGG - Intergenic
1158958871 18:62570920-62570942 CAGCCAGCAGTGAGAGCTTAGGG + Intronic
1159782195 18:72673148-72673170 CAGCCGGGAAAGAGAGCTTCTGG + Intergenic
1161733167 19:5974714-5974736 CAGGCAGGGTTGAGACCCGCTGG - Intronic
1162029522 19:7911357-7911379 CAGCCAGGAGTGAGGGCTTCTGG + Intronic
1162728038 19:12701538-12701560 CAGGCAGGGGTGAGACCATCTGG - Intronic
1164650176 19:29885744-29885766 TAGCCAGGGTTGACAGGCTCAGG - Intergenic
1164791377 19:30987294-30987316 CAGCCAGAGGTGAGTGCTTAGGG + Intergenic
1165480957 19:36063930-36063952 CAGCCAGGACTGAGAACTACTGG + Intronic
1166125143 19:40710673-40710695 CAGCCAGGGCTGAGAACTGCTGG - Intronic
1166567359 19:43773442-43773464 CAACCAAGGTTGAGAACCTCTGG - Intronic
1166631976 19:44414946-44414968 CAGGGAGGGTTGAGAGCCTCAGG - Intergenic
1166632402 19:44418631-44418653 CAGGGAGGGTTGAGAGCCTGAGG - Intronic
1166636205 19:44453694-44453716 CAGGGAGGGTTGAAAGCCTCAGG + Intergenic
1166637068 19:44459763-44459785 CAGGGAGGGTTGAGAGCCTCAGG + Intergenic
1166884371 19:45951075-45951097 CAGCTAGGGGTGAGAGCCACTGG + Intronic
1167264292 19:48475801-48475823 TAGTCAAGGTTGAGAGCTACTGG + Intronic
1167346061 19:48946465-48946487 CAGCCAGGGGTGGGAGCTCTGGG - Intergenic
1167389662 19:49186342-49186364 CAGCCAGATGTAAGAGCTTCAGG + Intronic
1168264744 19:55216617-55216639 CAGCCAGGATTGAAAGATCCAGG + Intergenic
1168416962 19:56175410-56175432 CACTCCTGGTTGAGAGCTTCCGG + Intergenic
1202649098 1_KI270706v1_random:164777-164799 CAGGGAGGGTTGAGAGCCTCGGG - Intergenic
925328703 2:3042217-3042239 CTGCCCGGGCTGAGAGCTCCTGG - Intergenic
925388937 2:3482643-3482665 CAGCCAGGGTTGGGAGCCCTGGG - Intronic
925894778 2:8462893-8462915 CAGCCAGGGGTGAGGGGCTCTGG + Intergenic
927481796 2:23459766-23459788 CCACCAGTGTTGAAAGCTTCTGG + Intronic
928095345 2:28401355-28401377 TAGCCAGGGTTGAGAACCACTGG + Intronic
928434910 2:31248680-31248702 CAGCCAGGCTTGTGATCCTCTGG + Intronic
928493918 2:31812613-31812635 TAGCCAGGGTTGACAGTTTAGGG - Intergenic
928732576 2:34249372-34249394 CAGCCAGAGGTGAAAGCTTAGGG + Intergenic
929413507 2:41723851-41723873 CAGCCAAGGTTGAGATCAACTGG - Intergenic
929876930 2:45804436-45804458 CTTCCAGGGTTGAGAGCTCCTGG + Intronic
930543621 2:52739026-52739048 CAGCCAGTGTTGGGATCTTAGGG - Intergenic
930957499 2:57219968-57219990 CAGCCAGAGTTGAGGACTTAGGG - Intergenic
931264592 2:60649588-60649610 CAGCCAGGGATAAGAACTACTGG + Intergenic
931287087 2:60841262-60841284 CAGCCAGGGTTGAGAAACACTGG + Intergenic
931968807 2:67563332-67563354 CAGCCAAGGTTGAGAGCTACTGG + Intergenic
932234251 2:70108549-70108571 CAGCCATGGTTGAGAACCACTGG + Intergenic
932302864 2:70679269-70679291 CAGCCAGGGCTGGGAGCCACTGG - Intronic
932763124 2:74453033-74453055 CAGACAGGGTTGAGAAGGTCAGG - Intergenic
933387433 2:81629093-81629115 AAGGAAGGTTTGAGAGCTTCCGG - Intergenic
933688755 2:85163083-85163105 CAGCCAGGGTTGAGAGCCACTGG - Intronic
934524753 2:95044785-95044807 CAGCCTGGGCTCTGAGCTTCCGG - Intronic
935346715 2:102115038-102115060 CAGCCAGGGTTGACAACTACTGG - Intronic
935583899 2:104783741-104783763 CAGCCAGGGCTAAGAGCCACTGG - Intergenic
935719642 2:105968618-105968640 CAGCCAGGGTAGGTATCTTCTGG + Intergenic
936094224 2:109519517-109519539 CAGCCAGGGCTGAGTTCTTGAGG - Intergenic
936456044 2:112675112-112675134 CAGCCAAGGTTGAGAACCACTGG - Intergenic
938294866 2:130171862-130171884 CAGCCAGGCATGAGAGCCCCTGG + Intronic
938461764 2:131501973-131501995 CAGCCAGGCATGAGAGCCCCTGG - Intergenic
938541043 2:132283751-132283773 CAGGGAGGGTTGAGAGCCTCAGG + Intergenic
938541866 2:132289656-132289678 CAGGGAGGGTTGAGAGCCTCAGG + Intergenic
939584502 2:143990164-143990186 CAGCCAGGATTGAGAACTACTGG - Intronic
939670521 2:145006212-145006234 CAGCTAGAGTTGAGAGCTACTGG + Intergenic
941099431 2:161280574-161280596 CAGGGAGAGTTGAGAGCCTCAGG - Intergenic
942383645 2:175419385-175419407 CAGCCAGGGTTGAGAACCACTGG - Intergenic
942398409 2:175576302-175576324 CAGCCAGGGTTGGGAGCCCCTGG - Intergenic
942597823 2:177608932-177608954 CAGCCAAGGTTGAGAACCGCTGG - Intergenic
943909988 2:193551574-193551596 CAGCCAGAGTTTAGAGATTGGGG - Intergenic
944338460 2:198565991-198566013 CTGCCATGATTGAAAGCTTCCGG + Intronic
944659016 2:201904896-201904918 CAGCCAAGGTTGAGAACTACTGG - Intergenic
944860135 2:203808034-203808056 CAGCCAGGGTTGAAAACCACTGG + Intergenic
945634382 2:212329540-212329562 TAGCCAGGGTGGAGAACTCCTGG - Intronic
946697356 2:222372811-222372833 CAGCCAGGCTTGTGTCCTTCAGG - Intergenic
946798638 2:223385088-223385110 CATCCAAGGTTGAGAACTGCTGG - Intergenic
947401455 2:229735239-229735261 CAGCCAGAGGTGAGAGATTAGGG - Intergenic
947773284 2:232687768-232687790 CAGCCAGGACTGAGCACTTCTGG - Intergenic
948376056 2:237521011-237521033 CACCTAGGGCTGCGAGCTTCAGG + Intronic
948927875 2:241110975-241110997 CAGGCAGCGTTGAGCTCTTCTGG - Intronic
1168925339 20:1574572-1574594 CAGCCAAGGTTGAAAGCCACTGG + Intronic
1168929217 20:1607600-1607622 CAGCCAAGGTTGAAAGCCACTGG + Intronic
1169017025 20:2300380-2300402 CAGCTGGGGTTGAGAGCCTCTGG + Intronic
1169281624 20:4272574-4272596 CAGCCAGAGGTGAGAGCTGAGGG + Intergenic
1170489840 20:16861881-16861903 CAGCCATGGGTGTGAGCTGCGGG - Intergenic
1170622190 20:18005458-18005480 CAGCCAGGGCTCAGTGCTGCTGG - Intronic
1170718850 20:18857265-18857287 CAGCCAAGGTTGAGAGCAACTGG - Intergenic
1171869952 20:30516756-30516778 CAGGGAGGGTTGAGAGCCTCAGG + Intergenic
1171870742 20:30522537-30522559 CAGGGAGGGTTGAGAGCCTCAGG + Intergenic
1172356945 20:34286923-34286945 CTGCCAAGGTTGAGAACTCCCGG + Intronic
1172828871 20:37814775-37814797 CAGCTAGTGTTGAGAGCTACTGG + Intronic
1172879964 20:38193607-38193629 CAGGCAGGGGTGAGAGCTGAGGG - Intergenic
1173163989 20:40673390-40673412 CAGCCAGGGCTCTGAGCATCTGG + Intergenic
1174083126 20:47984779-47984801 CAGCCAGGGTTGAAAGCCACCGG - Intergenic
1174174000 20:48633703-48633725 CAGCCAGGGCTGGGAACTTCTGG - Intronic
1174645205 20:52079672-52079694 CAGGCACGGTGGAGAGCTACTGG + Intronic
1174696633 20:52565895-52565917 CAGCCAAGGTTGAGAACCACTGG - Intergenic
1175326735 20:58134685-58134707 CAACCAGGGGTGAGAGCTCTCGG - Intergenic
1175427521 20:58878095-58878117 CAGGCTGTGTTGAGAGCCTCTGG + Intronic
1176124349 20:63468842-63468864 CAGCCTGAGATGAGAGCTTGGGG - Intronic
1176602718 21:8807765-8807787 CAGGGAGGGTTGAGAGCCTCGGG + Intergenic
1176611660 21:8989621-8989643 CAGGGAGGGTTCAGAGCCTCAGG - Intergenic
1176861630 21:14014258-14014280 CAGACAAGGCTGAGAGCTCCAGG + Intergenic
1177556198 21:22691849-22691871 CAGACAGGATTAAGAGCATCTGG - Intergenic
1178024398 21:28449678-28449700 CAGCCAAGGTAGAGAACTACAGG + Intergenic
1178181211 21:30163568-30163590 CAGCCAGGGTTGAAATCTACCGG + Intergenic
1178688236 21:34728461-34728483 AAGCCAGGGTTGAGATCAGCTGG + Intergenic
1179313910 21:40223902-40223924 CAGGAAGGATGGAGAGCTTCTGG + Intronic
1179372041 21:40815329-40815351 CAGCCCAGGTTGAGGGCTTAGGG - Intronic
1180034473 21:45236726-45236748 CATCCAGGGTGGAGAGGTGCTGG - Intergenic
1180345003 22:11699322-11699344 CAGGGAGGGTTGAGAGCCTCGGG + Intergenic
1180352732 22:11817539-11817561 CAGGGAGGGTGGAGAGCCTCAGG - Intergenic
1180385518 22:12174818-12174840 CAGGGAGGGTGGAGAGCCTCAGG + Intergenic
1181772004 22:25132364-25132386 CAGCCAGGGCTGAGACCCACTGG + Intronic
1183275273 22:36892534-36892556 CAGCCTGGGAAGAGAGCTCCAGG - Intergenic
1184329355 22:43816787-43816809 CAGCAAGGGTTTTGAGTTTCTGG - Intergenic
949243370 3:1896360-1896382 CAAGCAGGGTTCAGAGCTGCTGG + Intergenic
950129746 3:10533982-10534004 CAGCCTGGGAAGAGAGCTGCTGG - Intronic
950778387 3:15370241-15370263 CAGCCAAGGTTGAGAACTAGTGG + Intergenic
950923785 3:16720349-16720371 CAGCCAGGGTTGAGAACCACTGG + Intergenic
950943902 3:16924556-16924578 CAGCCAGAGGTGAGAGTTTAGGG + Intronic
951360592 3:21720175-21720197 CAGCCAAGGCTGAGAGCCACTGG + Intronic
951955577 3:28249683-28249705 CAGCCAGGGTTGAGAGCTTCTGG + Intronic
952180766 3:30914158-30914180 CAGCCAGGTTTGAGAATTGCTGG + Intergenic
952414254 3:33076160-33076182 CAGCCAAGGTTGAGAACCACTGG + Intronic
953457012 3:43051467-43051489 CAACCAGAGGTGAGAGCTTAGGG + Intronic
953461308 3:43083337-43083359 CAGCCAGGCTTGAGAACATCTGG - Intronic
953467681 3:43138181-43138203 CAGACAGAGGTGAGAGCTTAGGG + Intergenic
953788752 3:45930441-45930463 CAGCCAAGGTTGAGAACCACTGG - Intronic
953826189 3:46252966-46252988 CAGCCAAGGTTGACAACTCCTGG - Intronic
954197006 3:49002846-49002868 CAGGCAGAGTTGAGAGCCTGGGG + Intronic
954802576 3:53195730-53195752 CAGCCAGGGCTGAGACCCGCTGG - Intergenic
955187915 3:56732677-56732699 CAGCCAGGGTTGCCAACTTTGGG + Intronic
955972836 3:64452776-64452798 TAGCCAGGGTTAAGAACTGCTGG - Intergenic
956247388 3:67198932-67198954 CAGCCATGGTTGAGAGCCATTGG - Intergenic
958562170 3:95760157-95760179 CAGCCAGGGCTGTGTGCTCCTGG - Intergenic
958977363 3:100682715-100682737 CAGCCTGGAGTGGGAGCTTCAGG - Intronic
959355713 3:105325329-105325351 CAGGCAGGGTGGAGACCTTGTGG - Intergenic
960902730 3:122567970-122567992 CAGACAGGGCTGAGAACCTCTGG + Intronic
962266501 3:133948103-133948125 CAGCCTGGGTTGAGAATCTCTGG + Intronic
962676544 3:137762381-137762403 CAGCCAGGGATAGGAGATTCAGG - Intergenic
962938269 3:140101719-140101741 AAGGCATGGTTCAGAGCTTCAGG + Intronic
963767249 3:149350417-149350439 CAGCCAGGGTTGGGACCCACTGG - Intergenic
964824167 3:160807087-160807109 CAGCCAAAGTTGAGAGCCACTGG + Intronic
964868877 3:161291353-161291375 CAGGCAGGGTTCAGAGATCCTGG + Intergenic
965621365 3:170645069-170645091 CAGCCAGACTTGAGAACTCCTGG - Intronic
965666964 3:171105455-171105477 CAGCCGTGGTTGAGAGCCACTGG + Intronic
965691447 3:171361126-171361148 CAGCCAGGATAGAGAGCTGCTGG - Intronic
965719000 3:171640685-171640707 CAGCCAGAGGTGAGAGCTTAGGG + Intronic
967186872 3:186951424-186951446 CAGCCAGGGTTGAGAACCAATGG - Intronic
967743427 3:193028386-193028408 CAGCCAAGGTTGAGAACCACTGG - Intergenic
969388911 4:6876011-6876033 CAGCCAGGGTTGAGAACTACTGG + Intronic
969585257 4:8087851-8087873 CAGCCAGGGATGGAAGTTTCTGG - Intronic
969623894 4:8292832-8292854 CAGCCATGGATAGGAGCTTCAGG - Intronic
970235427 4:13953712-13953734 AAGCCAGGACTGAGAACTTCTGG - Intergenic
972939151 4:44176273-44176295 CAGCCAGAGTTGAGAACAACTGG + Intronic
972983502 4:44734859-44734881 TAGCCATGGGTGAGAGCTTGGGG + Intergenic
972989007 4:44800486-44800508 CAGCCAGAGGTGAGAGATTATGG + Intergenic
973375369 4:49282650-49282672 CAGGGAGGGTTGAGAGCCTCAGG + Intergenic
973376271 4:49288663-49288685 CAGGGAGGGTTGAGAGCCTCAGG + Intergenic
973377190 4:49294818-49294840 CAGGGAGGGTTGAGAGCCTCAGG + Intergenic
973378112 4:49300954-49300976 CAGGGAGGGTTGAGAGCCTCAGG + Intergenic
973379060 4:49307252-49307274 CAGGGAGGGTTGAGAGCCTCAGG + Intergenic
973380037 4:49314398-49314420 CAGGGAGGGTTGAGAGCCTCAGG - Intergenic
973380953 4:49320553-49320575 CAGGGAGGGTTGAGAGCCTCAGG - Intergenic
973382042 4:49327591-49327613 CAGGGAGGGTTGAGAGCCTCAGG - Intergenic
973385570 4:49512206-49512228 CAGGGAGGGTTGACAGCCTCAGG - Intergenic
973861001 4:55064692-55064714 GAGGTAGGGGTGAGAGCTTCTGG + Intergenic
975075293 4:70199584-70199606 AAGCCAGGATGGAGAGCTACTGG - Intronic
977575840 4:98673480-98673502 CAGCCAGAGTTGAGCACCTCAGG - Intergenic
979494638 4:121369955-121369977 CAGGCAGGGCTGAGAGATCCTGG - Intronic
982442496 4:155453378-155453400 CACCTAGGGCTGTGAGCTTCAGG + Intergenic
983595932 4:169468159-169468181 CAGCCAGAGGTGAGAGATTAGGG + Intronic
984950228 4:185002549-185002571 CAGCCTGGGTTGAGACCCACTGG + Intergenic
985651465 5:1109671-1109693 CAGCCTGGGTTGGGGGGTTCTGG - Intronic
988447475 5:31304243-31304265 CAGCCAGAATTGAGAGCCACAGG - Intronic
988957427 5:36333226-36333248 CAGCCAGGCTTGAGAAGTCCTGG - Intergenic
988996316 5:36718121-36718143 CAGCCAAGGATGGGAGCTTGTGG + Intergenic
989184509 5:38610222-38610244 CAGCCAGTGTTGAGAACCTCTGG - Intergenic
990777345 5:59317044-59317066 CAGCCTGGATTGACAGCTGCAGG - Intronic
990856696 5:60275223-60275245 CAGCCAAGGTTGAGAACCACTGG + Intronic
991173830 5:63661565-63661587 CAGCCAGGGTTGAGTACTACTGG + Intergenic
991430500 5:66539810-66539832 CAGGAAGGGTTGACAGCCTCTGG - Intergenic
992107590 5:73462807-73462829 CAACCAGGGCTGAGAACTGCTGG - Intergenic
992155656 5:73952930-73952952 CAGCCAGTGCTCAGAGCCTCTGG - Intergenic
992712307 5:79471604-79471626 CAGCCAGGGTTGAGAAACACTGG - Intronic
992870259 5:80998757-80998779 CAGCCAGGCTTGGGGGCTTCTGG + Intronic
994109725 5:95987542-95987564 CAGCCAGTGTTGAGAACCACAGG + Intergenic
994115150 5:96053301-96053323 CAGCCAAGGTTGAGAGCCATTGG + Intergenic
994172197 5:96669845-96669867 CAGCCAGGATTGAGAACCACTGG - Intronic
994737533 5:103573676-103573698 CAGCCAGGATTGAGAGCCTTAGG + Intergenic
994780562 5:104084478-104084500 GAGCCAAGTTTGAGAGCTACAGG + Intergenic
995057870 5:107781328-107781350 CAGCTAGAGTTGAGAGATTAGGG + Intergenic
995507380 5:112874329-112874351 GAGCCAGGGTTGAGACCCACTGG - Intronic
995507389 5:112874390-112874412 GAGCCAGGGTTGAGACCCACTGG - Intronic
997657980 5:135569334-135569356 CAGACAGGGTGGAGTCCTTCTGG + Intergenic
997712307 5:136015964-136015986 CAGCCAGGGTTGAGAACCACTGG + Intergenic
997999755 5:138615643-138615665 CAGCCAGGGCAGAGAGCAGCGGG + Intronic
998378858 5:141709743-141709765 CAGCCAGGGTTCAGAGGGTCTGG - Intergenic
998403324 5:141859459-141859481 CAGCAAGTGTCTAGAGCTTCAGG - Intronic
999053535 5:148549463-148549485 CAGCCTGGGATGAGAGCCTCTGG - Intronic
999313619 5:150569695-150569717 TAACCAGGTTTGGGAGCTTCTGG + Intergenic
1000040934 5:157484766-157484788 AAGCCAGGATAGAGACCTTCTGG + Intronic
1000259345 5:159571806-159571828 CAGCCAGAAGTGAGAGCTTAGGG + Intergenic
1000561849 5:162799110-162799132 CATCCAGGGTTGAGAACCACTGG - Intergenic
1000683948 5:164223775-164223797 CAGCCACCATTTAGAGCTTCAGG - Intergenic
1001690335 5:173628294-173628316 CAGCCTGGGTTCAGAGCTAGGGG + Intergenic
1002019092 5:176350680-176350702 CAGGCAGGGCTGAGAGATGCTGG - Exonic
1002293685 5:178216319-178216341 TAGCCAGTGGTGAGAGCTTAGGG - Intronic
1002428704 5:179190957-179190979 CAGCCAGCGGGGAGAGCTCCAGG - Intronic
1002866881 6:1129681-1129703 CGGCCAGGACTGTGAGCTTCAGG - Intergenic
1004518584 6:16341483-16341505 CAGCCAGAGGTGAGAACCTCTGG + Intronic
1004569857 6:16834670-16834692 CAGCCAGGGCTGAGAGCCACTGG + Intergenic
1005227319 6:23657643-23657665 CAGCCAGGGTTAAGAGCTCCGGG - Intergenic
1005861837 6:29907973-29907995 CAGCCAGGGTAGAGGGGTTGAGG + Intergenic
1007318243 6:41007457-41007479 CATCCAGGGTTGAGAACTACTGG + Intergenic
1007687950 6:43678362-43678384 CAGCCAGGGTTGAGAACAACTGG + Intronic
1007691163 6:43702501-43702523 CAGCCAGGGTTGAGAACCACTGG + Intergenic
1007826555 6:44605348-44605370 CAGCCATGGTTGAGAACCACTGG - Intergenic
1009935545 6:70230698-70230720 CAGCCAGGGTTGAGAACCACTGG - Intronic
1010153921 6:72769568-72769590 CAGCCAGGGTTGAGAAACTTTGG + Intronic
1010294559 6:74181520-74181542 CAGCTAGGTTTGAGATCTTCAGG + Intergenic
1011093743 6:83635364-83635386 CAGCCAGAGATGAGAGATTAGGG - Intronic
1011478782 6:87773776-87773798 CAGCCAGAGGTGACAGCTTAAGG - Intergenic
1013006733 6:106080977-106080999 AAGCCAGGGCTGATGGCTTCTGG + Intergenic
1013260065 6:108432868-108432890 CAGCCAGTGTTGAGAACCACTGG + Intronic
1013421934 6:109975064-109975086 CAGCCAGGATTGAGAACTGCTGG + Intergenic
1015172986 6:130275224-130275246 CAGTCAAAGTTGAGAGCTACTGG - Intronic
1015894922 6:138007912-138007934 CAGCCAACTTTGAGAGCTCCAGG - Intergenic
1015939129 6:138431397-138431419 CAGAAAGGAATGAGAGCTTCTGG + Exonic
1019001433 6:168756468-168756490 CAGCCAGAGTTGAGAGCACAGGG - Intergenic
1019603182 7:1895454-1895476 CAGGCGGGGCTGAGAGCTGCGGG - Intronic
1020399283 7:7756862-7756884 CAGCCAGGGTTGAAGACCTCAGG + Intronic
1021390631 7:20088450-20088472 CAGCCAGGATTGAGATCTTGTGG + Intergenic
1021596497 7:22322696-22322718 CATCGAGGGTTGAGAACTGCTGG - Intronic
1022525942 7:31037360-31037382 CAGCCAGGGCTGAGAACCACTGG - Intergenic
1022961106 7:35427487-35427509 CAGCCAGAGGTGAGAACTTAGGG - Intergenic
1023113089 7:36833974-36833996 CAGCCAAGCTTGAGAACTCCAGG + Intergenic
1023777309 7:43620140-43620162 GATCCATGGTTGAGTGCTTCTGG + Intronic
1023893217 7:44409188-44409210 CAGCCAGAGGTGAGAGCTTAAGG - Intronic
1024180555 7:46889099-46889121 AAGCCAGAGTTGAGAGATTAGGG + Intergenic
1024574669 7:50754134-50754156 CAGGCAGGTGTGCGAGCTTCAGG - Intronic
1026399691 7:69997064-69997086 CAGCCAGGGTTGAGATTTAACGG + Intronic
1026598537 7:71754165-71754187 CAGCCAGGGTTAGGAACCTCTGG + Intergenic
1027512871 7:79104867-79104889 CAAACAGGCGTGAGAGCTTCTGG - Intronic
1029272823 7:99386960-99386982 CTCACAGGGTTGAGGGCTTCAGG + Intronic
1029944135 7:104513840-104513862 CAGCCAAGGTTGAGAACCACTGG + Intronic
1030303315 7:107995728-107995750 CAGGCAGGCTTGAGAGCTCTAGG - Intronic
1032035763 7:128520232-128520254 CAGCCAGGGGTGAGAGGTGCAGG + Intergenic
1032114507 7:129105235-129105257 CAACCAGTGTTGAGAACTACTGG - Intergenic
1032543135 7:132720949-132720971 AGGCCAGGGTTGGCAGCTTCTGG + Intronic
1035357561 7:158285678-158285700 CAGACAAGGTTGAGAGCATAAGG - Intronic
1035588794 8:797670-797692 CAGGCAGGGCTGGGAGCTCCTGG + Intergenic
1035687612 8:1537127-1537149 CAGCCAGGCTGCAGAGCTGCAGG - Intronic
1035714169 8:1741162-1741184 CAGCCAGAGTTGAGACCTGAAGG + Intergenic
1036769139 8:11566800-11566822 TAGCCAGGGCTGAGAACTGCTGG - Intergenic
1038947453 8:32376725-32376747 CAGCCAGGTTTCAGGGCCTCAGG - Intronic
1040334785 8:46410527-46410549 CAGGCAGGCTGGAAAGCTTCAGG + Intergenic
1040639150 8:49311575-49311597 CAGCCAGAGGTGAGAGCTTAGGG - Intergenic
1040894943 8:52356142-52356164 CAGCCAGAGGTGACAGCTTAGGG - Intronic
1041297440 8:56373359-56373381 TAGCCAGGGTTGAGAGCCATTGG - Intergenic
1041452534 8:58021978-58022000 GAGCCAGTGTTGAGAGTTTCTGG + Intronic
1042238776 8:66641149-66641171 CATGAAGGGTTGAGAGCTGCGGG + Intronic
1043486144 8:80701119-80701141 CAGCCAGGGTTTGGTTCTTCTGG - Intronic
1044359047 8:91259950-91259972 CAGCCAGGGTTGAGAACTATAGG + Intronic
1044378967 8:91510541-91510563 CAGCCAGAGGTGAGAGCTGAGGG + Intergenic
1044623797 8:94216934-94216956 CAGCCGAGGTTGAGAACTGCTGG + Intronic
1044661526 8:94596066-94596088 CAGCCAGGATTGAGAACCACAGG - Intergenic
1045412890 8:101936741-101936763 CAGCCAAGGTTGAGAACCGCTGG + Intronic
1046217247 8:111164570-111164592 CAGCCAGGGGCGAAAGCTTTAGG + Intergenic
1046576854 8:116040310-116040332 CAGCCAGACTTGAAAACTTCTGG + Intergenic
1047199058 8:122748571-122748593 GACCCAGGGTTGAGAGCCACTGG + Intergenic
1047462810 8:125084809-125084831 CAGCCAGGCTTGAGAACCACTGG - Intronic
1048192102 8:132299454-132299476 CATCCAGGGTTGAGACCCACGGG + Intronic
1048872254 8:138809248-138809270 CAGCCAGGCCTCAGAGCTCCTGG + Intronic
1049048681 8:140173628-140173650 CAGTCAGGGTACAGATCTTCTGG + Intronic
1049242534 8:141545352-141545374 CAGGCCAGTTTGAGAGCTTCCGG + Intergenic
1049332700 8:142063645-142063667 CAGACAGGGCTGAGGGCTCCTGG + Intergenic
1049431109 8:142565479-142565501 CAGCCAGGGGTGACAGCCTGAGG + Intergenic
1049443001 8:142617690-142617712 CAGCCAGGGCTGAGACAGTCTGG - Intergenic
1049481034 8:142822840-142822862 CTGCTAGGGCTGAGGGCTTCTGG + Intergenic
1049715978 8:144092281-144092303 CAGCCAGAGGTGAGAGTTTAGGG + Intergenic
1049978313 9:881134-881156 CAGCCAGGTTTGAAAACTTCTGG + Intronic
1052989321 9:34509702-34509724 AAGACAGGGTTGAGAGCTGGTGG + Intronic
1053000428 9:34574605-34574627 CAGCCAGCGTCGAGAGCTGGGGG - Intronic
1053462240 9:38280061-38280083 CAGAAAGTGTTGAGAGCCTCAGG + Intergenic
1054875520 9:70092308-70092330 CAGCCAAGGTTGAGAACAGCTGG + Intronic
1055488250 9:76778044-76778066 CAGCCAAGGTTGGGAACCTCTGG - Intronic
1056137920 9:83647484-83647506 CAGCCAGGGGTGGGAGCCTCAGG + Intergenic
1056471670 9:86910443-86910465 CAGCCAGAGATGAGAGTTTGGGG - Intergenic
1056498908 9:87188947-87188969 CAGCCAGGGTTAAGAACCACAGG + Intergenic
1057907514 9:98994057-98994079 CAGCCAGGGCTGAGAACCACAGG - Intronic
1059531791 9:115042244-115042266 CAGCCCAAGTGGAGAGCTTCCGG - Exonic
1061180689 9:129023462-129023484 CAGCCAGGGTGAAGACCTGCAGG + Intronic
1061712397 9:132497391-132497413 CAGCCAGAGTGGAGAGATCCCGG + Intronic
1062272628 9:135716867-135716889 TGGCCAGGGATTAGAGCTTCGGG + Intronic
1203479782 Un_GL000224v1:1760-1782 CAGGGAGGGTGGAGAGCCTCAGG + Intergenic
1203480749 Un_GL000224v1:8056-8078 CAGGGAGGGTGGAGAGCCTCAGG + Intergenic
1203481710 Un_GL000224v1:14386-14408 CAGGGAGGGTGGAGAGCCTCAGG + Intergenic
1203549186 Un_KI270743v1:153970-153992 CAGGGAGGGTTGAGAGCCTCAGG - Intergenic
1203550140 Un_KI270743v1:160284-160306 CAGGGAGGGTTGAGAGCCTCAGG - Intergenic
1203567743 Un_KI270744v1:105897-105919 CAGGGAGGGTTGAGAGCCTCAGG + Intergenic
1203568803 Un_KI270744v1:112882-112904 CAGGGAGGGTTGAGAGCCTCAGG + Intergenic
1186818100 X:13258021-13258043 AAGCCAGAGTTGAGAGCTACTGG - Intergenic
1187288707 X:17931552-17931574 CATCCAGGGTTGAGAACCACTGG - Intergenic
1187291914 X:17962727-17962749 CAGCCAGAGTTAAGACATTCTGG - Intergenic
1187753644 X:22495766-22495788 CAGCCAAGGTTGAGAACATCTGG + Intergenic
1187809771 X:23162807-23162829 CATCCAGGGTTAAGAAGTTCTGG - Intergenic
1188024700 X:25195923-25195945 CAGCCAGGGTTAAGACCCTTGGG + Intergenic
1188298955 X:28484058-28484080 CAGCCCAGGTTGAGAACTCCTGG + Intergenic
1188377748 X:29453593-29453615 CAGCCAGAGTTGAGAGTTGTTGG - Intronic
1188850215 X:35123051-35123073 CAGCCAAGGTTGATTGCTACTGG - Intergenic
1189621675 X:42847177-42847199 CAGCCAGGGGTGAAAGTTTAGGG - Intergenic
1189625907 X:42896210-42896232 TAGCCAGTGTTGAGAACCTCTGG + Intergenic
1189941324 X:46125349-46125371 CAGCCAGAGGTGAGAGCTTATGG + Intergenic
1189989266 X:46578867-46578889 CAGCCAGGGCTGAGAACCGCTGG - Intronic
1191872097 X:65755968-65755990 CAGCCAGAGGTGAGAGCTTAGGG + Intergenic
1192356805 X:70411700-70411722 CAGCCAGAGTTGAGAACAACTGG + Intronic
1192562505 X:72136699-72136721 CAGCCAGGGGTGAGAACCACTGG - Intronic
1195866397 X:109437586-109437608 CAGCCTGGGTTGAGAATTGCTGG - Intronic
1195879880 X:109581504-109581526 CAGCCAGGGTTGAGAACCACTGG - Intergenic
1197253847 X:124242010-124242032 CAGCCAAGGTTGAGAACTATTGG + Intronic
1197657385 X:129131882-129131904 CAGAAAGGGTTGAGAGTTCCTGG - Intergenic
1198070921 X:133147846-133147868 CAGCCAGAGATGAGAGATTAGGG + Intergenic
1198576942 X:138020942-138020964 CACCCAGAGTTGAAAGCTTAAGG + Intergenic
1200287630 X:154838854-154838876 CAGCCAGGGTTGGGAACCTAGGG - Intronic
1201428169 Y:13877089-13877111 GAGCCAGGTTTGACAACTTCAGG + Intergenic