ID: 951965674

View in Genome Browser
Species Human (GRCh38)
Location 3:28381912-28381934
Sequence CACCTTGGCCTCCTATTGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 786
Summary {0: 1, 1: 2, 2: 34, 3: 171, 4: 578}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951965674_951965680 -7 Left 951965674 3:28381912-28381934 CCCAGCAATAGGAGGCCAAGGTG 0: 1
1: 2
2: 34
3: 171
4: 578
Right 951965680 3:28381928-28381950 CAAGGTGGGCGGATCACCTGAGG 0: 1923
1: 14837
2: 43981
3: 78006
4: 95526
951965674_951965683 25 Left 951965674 3:28381912-28381934 CCCAGCAATAGGAGGCCAAGGTG 0: 1
1: 2
2: 34
3: 171
4: 578
Right 951965683 3:28381960-28381982 CGAGACCATCCAGACCAACATGG 0: 2
1: 677
2: 29640
3: 142000
4: 209897
951965674_951965681 -2 Left 951965674 3:28381912-28381934 CCCAGCAATAGGAGGCCAAGGTG 0: 1
1: 2
2: 34
3: 171
4: 578
Right 951965681 3:28381933-28381955 TGGGCGGATCACCTGAGGTCAGG 0: 6256
1: 38634
2: 78388
3: 109169
4: 111926

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951965674 Original CRISPR CACCTTGGCCTCCTATTGCT GGG (reversed) Intronic
900268147 1:1770796-1770818 CACCTCGGCCTCCCAGTGTTGGG - Intronic
900960582 1:5916757-5916779 CACCTTGGCCCCAGAATGCTGGG - Intronic
901222878 1:7593791-7593813 TGCCTTGGCCTCCTAGTGTTAGG - Intronic
901308221 1:8249059-8249081 CACCTTGGCCTCCCAATATTGGG - Intergenic
901568806 1:10142420-10142442 CACCTCGGCCTCCCAGTGTTGGG - Intronic
901606179 1:10461156-10461178 CCCCTCGGCCTCCCAGTGCTGGG + Exonic
901860385 1:12070572-12070594 TGCCTGCGCCTCCTATTGCTGGG + Intronic
902902743 1:19530986-19531008 CGCCTTGGCCTCCCAGTGCTGGG + Intergenic
903883492 1:26528391-26528413 CGCCTCGGCCTCCCAGTGCTGGG + Intergenic
903956414 1:27029188-27029210 CATCTTGGCCTCTTATTGGCTGG + Intergenic
904189500 1:28732688-28732710 CACCTTGGCCTCCCAGTGTTGGG + Intergenic
904306645 1:29594251-29594273 CACCATGGCCTCCTTTAGCTAGG - Intergenic
904524496 1:31122542-31122564 CAAGTTGGCCTCCAATTCCTGGG - Intergenic
904700452 1:32354852-32354874 CTCCTCGGCCTCCCAGTGCTGGG + Intronic
904744866 1:32704237-32704259 CACCCTTGCCGCCTGTTGCTTGG - Intergenic
905187292 1:36205600-36205622 CACCTCAGCCTCCCAGTGCTGGG - Intergenic
905189421 1:36222146-36222168 CGCCTTGGCCTCCCAGTGTTGGG + Intergenic
905362849 1:37432167-37432189 CACCTTGGCATCCCAGTGCTGGG - Intergenic
906121057 1:43391064-43391086 CACCTCGGCCTCCCAGTGTTGGG - Intronic
906382010 1:45338877-45338899 CACCTCAGCCTCCTGTAGCTGGG + Intronic
906625883 1:47325258-47325280 CACCTCGGCCTCCCAGTGCTGGG - Intergenic
906670827 1:47653331-47653353 CACCTTGGCCTCCCAGTGCTGGG + Intergenic
906988565 1:50713044-50713066 CACCTCAGCCTCCTGTAGCTGGG - Intronic
907138914 1:52166662-52166684 TACCTTGGCCTCCTCACGCTGGG - Intronic
907206286 1:52774676-52774698 CACCTTGGCCTCCTAGTTTTGGG + Intronic
907813316 1:57894028-57894050 CACAGTGGCCTGCTAGTGCTTGG - Intronic
908639498 1:66206135-66206157 CACCATGGCCTGCCACTGCTAGG + Intronic
908919817 1:69175717-69175739 CACCTTGGCCTCCTAAAGTGCGG - Intergenic
909003202 1:70243798-70243820 CACCTTGGCCTCCCAGAGTTGGG - Intronic
909031451 1:70545837-70545859 CACCTTGGCCTCCCAGTGTTGGG + Intergenic
909147735 1:71958703-71958725 CACCTAAGCCTCCCAGTGCTGGG - Intronic
909264747 1:73542181-73542203 CACCTCGGCCTCCCAGTGTTGGG + Intergenic
909446470 1:75754456-75754478 CACCTTGGCCTCCCAGTGTTGGG + Intronic
909492115 1:76237380-76237402 CGCCTTGGCCTCAAAATGCTGGG + Intronic
909626054 1:77717113-77717135 TGCCTTGGCCTCCCAGTGCTGGG + Intronic
909626831 1:77726394-77726416 CACCTTGGCCTCCCAGTGTTGGG - Intronic
910227711 1:84953301-84953323 CACCTTGGCCTCCTAAAGAGCGG - Intronic
910404959 1:86878429-86878451 TGCCTTGGCCTCCCAATGCTGGG - Intronic
911648794 1:100363904-100363926 CACCTTGGCCTCCCAAAGCGTGG - Intronic
912708767 1:111934470-111934492 CACCTGGGCCTTCTATGTCTGGG - Intronic
913003358 1:114603785-114603807 CACCTTAGCCTCAAAGTGCTAGG + Intronic
914822675 1:151116896-151116918 CACCTTGCCCTGCCATTTCTGGG + Intronic
914841479 1:151252614-151252636 CACCTCGGCCTCTCAGTGCTGGG + Intergenic
915122196 1:153636306-153636328 CACCTTGGCCTCCCAGTGTTGGG - Intronic
915175667 1:154012753-154012775 CGCCTCGGCCTCCCAGTGCTGGG - Intronic
915400032 1:155615526-155615548 CACCTTGACCTCTTTTTGCCAGG + Intergenic
915417238 1:155751721-155751743 CACCTTGACCTCTTTTTGCCAGG + Intronic
915551960 1:156640665-156640687 CACCTTGGCCTTCCAATGCTGGG + Intergenic
916532507 1:165670955-165670977 CACCTTAGCCTCCTATAGCTGGG - Intronic
916684170 1:167129520-167129542 CACCTTCGCTTCTTATTCCTAGG + Intergenic
916730298 1:167560502-167560524 TGCCTTGGCCTCCCAGTGCTGGG - Intergenic
917835930 1:178941623-178941645 CACCTTGGCCTCCTAAAGTGCGG - Intergenic
917863564 1:179171759-179171781 CACCTTGGCCTCCCAGTGCTGGG + Intronic
917867430 1:179210602-179210624 CACCTCGGCCTCAAAGTGCTGGG - Intronic
917976522 1:180243325-180243347 TACCTTGGCCTCCTCTTGCAGGG - Intronic
918015018 1:180624678-180624700 CACCTTGGCCTCCCAAAGCGTGG + Intergenic
918068276 1:181116663-181116685 CACCTCAGCCCCCTATAGCTGGG + Intergenic
918190571 1:182170178-182170200 CACCTCAGCCTCCTGTAGCTGGG - Intergenic
918270395 1:182892935-182892957 CACCTCGGCCTCTTAGTGTTGGG - Intergenic
919059522 1:192613953-192613975 TGCCTTGGCCTCCCAGTGCTGGG - Intergenic
919950571 1:202359529-202359551 TGCCTTGGCCTCCCAGTGCTAGG - Intronic
920131349 1:203734456-203734478 CACCTCGGCCTCCTAAAGTTGGG - Intronic
920379442 1:205527228-205527250 TGCCTTGGCCTCCCAGTGCTGGG - Intronic
920495349 1:206450861-206450883 CGCCTGGGCCTCCCAGTGCTGGG - Intronic
920517126 1:206593618-206593640 CACCTCGGCTGGCTATTGCTTGG - Exonic
920879139 1:209864050-209864072 CACAGTGGCCTGCTAGTGCTGGG + Intergenic
921374296 1:214458294-214458316 CATCTTGGCCTCCCAGTGTTAGG + Intronic
921498509 1:215870541-215870563 CACCTCGGCCTCCCACTGCTGGG + Intronic
921726796 1:218533245-218533267 CACCTCAGCCTCCCAGTGCTGGG + Intergenic
922462640 1:225825076-225825098 CACTTTGCCCTCCTCTTCCTGGG + Intronic
922479310 1:225928010-225928032 CTCCTTGGCCTCCCAGTGTTAGG + Intergenic
923481191 1:234385746-234385768 CACCTCGGCCTCCCAATGCTAGG + Intergenic
923598107 1:235376723-235376745 CACCTCGGCCTCCAAGTGCTGGG - Intronic
924489885 1:244526157-244526179 CACCTCAGCCTCCCAATGCTGGG - Intronic
924724522 1:246656814-246656836 CACCTTAGCCTCCTGTAGCTGGG - Intronic
1063126361 10:3139774-3139796 CGCCTTAGCCTCCTGTAGCTAGG + Intronic
1063449593 10:6142606-6142628 CACCTCGGCCTCCCAGTGCTGGG + Intergenic
1063640393 10:7823879-7823901 CACCTCGGCCTCTCAGTGCTGGG + Intronic
1063921226 10:10935167-10935189 CACCTTGGCCTGGTATTCTTTGG + Intergenic
1063976231 10:11417974-11417996 CACCTTGGCCTCAAAGTGCTGGG + Intergenic
1064049254 10:12046040-12046062 CGCCTTGGCCTCCCAGTGTTGGG - Intergenic
1064542914 10:16423335-16423357 CGCCTTTGCCTCCCAGTGCTGGG - Intergenic
1064884095 10:20090379-20090401 CACCAGGGCCACCTCTTGCTTGG - Intronic
1065607777 10:27437023-27437045 CGCCTTGGCCTCCCAGTGTTGGG - Intergenic
1066109670 10:32184717-32184739 CACCTTGGCCTCCCAAAGTTGGG - Intergenic
1066660523 10:37735075-37735097 CACCTTGGCCTCCTAAAGTGCGG + Intergenic
1068016320 10:51521038-51521060 CGCCTTGGCCTCCCAGTGCTGGG - Intronic
1069291017 10:66779609-66779631 TGCCTTGGCCTCCCAGTGCTGGG + Intronic
1069378975 10:67822737-67822759 CACCTCGGCCTCCCAGTGCTGGG - Intronic
1069489689 10:68850721-68850743 TGCCTTGGCCTCCCAGTGCTGGG - Intronic
1069519813 10:69109931-69109953 CACCTTGGCCTCCCAATGCTAGG - Intergenic
1069927526 10:71861207-71861229 CACCTAAGCCTCCTGTAGCTGGG - Intergenic
1070002532 10:72391181-72391203 CGCCTTGGCCTCCCAGTGTTGGG - Intronic
1070023478 10:72609389-72609411 CACCTTGGCCTCCCAAAGCGTGG - Intronic
1070158312 10:73850243-73850265 CACCTTGGCCTCTCAGTGTTGGG + Intronic
1071563778 10:86661413-86661435 CACCTTGGCCTCCAAGGGCCTGG + Intronic
1072138294 10:92567855-92567877 CACCTCAGCCTCCTGTAGCTAGG - Intronic
1072232824 10:93427282-93427304 CACCTTGGCCTCCCAGTGCTGGG - Intronic
1072822452 10:98571410-98571432 CACATTGGTCTCCTTTTGCAAGG - Intronic
1072978590 10:100080642-100080664 CACCTTGGCCTCCCAGTGTTGGG - Intronic
1073021482 10:100448346-100448368 CGCCTTGGCCTCCCAGTGCTGGG + Intergenic
1073157382 10:101358351-101358373 TGCCTTGGCCTCCCATTGTTGGG + Intronic
1073324958 10:102638317-102638339 CACCTTGGACTCAGAGTGCTGGG - Intergenic
1073381489 10:103081108-103081130 CTCCCTGGCCTGCTCTTGCTTGG - Exonic
1073567797 10:104550217-104550239 CACCTCAGCCTCCCAGTGCTAGG + Intergenic
1074144998 10:110709817-110709839 CACCTTGGCCTCCCAAAGTTGGG + Intronic
1077001940 11:327765-327787 TGCCTTGGCCTCCCAGTGCTGGG - Intergenic
1077778506 11:5298186-5298208 CACCCTGGCCTCCTAATGATAGG - Intronic
1078198051 11:9153071-9153093 CGCCTTGGCCTCCCAGTGTTGGG - Intronic
1078216720 11:9318009-9318031 CACCTCGGCCTCCCAGTGCTGGG + Intergenic
1078275380 11:9839984-9840006 CACCTCAGCCTCCCAGTGCTGGG - Intronic
1078512601 11:11996796-11996818 CACCTTGGCCCCCTTGTGCAGGG - Intronic
1079410886 11:20186460-20186482 CACCTTGGCCTCCTTTGGCTGGG - Intergenic
1080436794 11:32252321-32252343 CACCCTGGCCTCCCAGTGCTGGG + Intergenic
1080520355 11:33063111-33063133 CTCCTTGGCCTCCCAGTGTTGGG + Intronic
1080692797 11:34572948-34572970 CACCTTGGCCTCCCAAAGCTGGG + Intergenic
1080800637 11:35606937-35606959 CACCTTGGCCTCTCACTCCTGGG - Intergenic
1080826543 11:35853519-35853541 TACCTTGGCCTCCCAGTGTTGGG - Intergenic
1081914383 11:46721288-46721310 CACCTCGGCCTCAAAGTGCTGGG + Intronic
1083223104 11:61266289-61266311 CACCTTGGCCTCCCAAGGTTTGG - Intronic
1083559905 11:63665095-63665117 CACCTTGGCCTTCCAGTGTTGGG - Intronic
1083575369 11:63787055-63787077 TACCTTGGCCTCAAAGTGCTGGG + Intergenic
1083751250 11:64761933-64761955 CACCTCGGCCTCAAAGTGCTAGG - Intergenic
1083983979 11:66198161-66198183 CGCCTTGACCTCCCAGTGCTGGG + Intronic
1084062316 11:66684383-66684405 CACCTTGGCCTCAAACTGTTGGG - Intergenic
1084085931 11:66855269-66855291 CACCATGGCCACCCAGTGCTGGG - Intronic
1084541592 11:69790271-69790293 CACCTTGGCCTCCCAAAGCGTGG - Intergenic
1084584541 11:70049967-70049989 CGCCTTGGCCTCCCAAAGCTGGG + Intergenic
1085071137 11:73547034-73547056 CACCTTGGCCTCCCAGTGCTAGG - Intronic
1085228465 11:74944068-74944090 CACCTTGGCCTCCCACTGGAAGG + Intronic
1085280615 11:75327835-75327857 CACCTTGGCCTCCCAGTGCTGGG + Intronic
1085623442 11:78054467-78054489 CACCTTGGCCTCCCAAAGCTGGG - Intronic
1085633610 11:78140433-78140455 CACCTCGGCCTCCCAGTGTTGGG - Intergenic
1085911421 11:80831257-80831279 CACTTTTTCCTCCTTTTGCTCGG + Intergenic
1086267732 11:85021237-85021259 CTCCTCCTCCTCCTATTGCTCGG - Intronic
1086572570 11:88302373-88302395 CGCCTCGGCCTCCCAATGCTGGG - Intronic
1087067968 11:94045154-94045176 TGCCTTGGCCTCCCATTGCTGGG + Intronic
1087197927 11:95319173-95319195 CACCTAGGCTTCTAATTGCTAGG - Intergenic
1087836389 11:102879534-102879556 CGCCTTGGCCTCCCAATGCTGGG + Intergenic
1087947049 11:104175492-104175514 CACCTCGGCCTCCCAAAGCTGGG - Intergenic
1088067183 11:105733702-105733724 CACCTTGGCCTCCCAGTGTTGGG + Intronic
1088652368 11:111969177-111969199 CGCCTTGGCCTCCCAGTGCTGGG - Intronic
1089435102 11:118458335-118458357 CTCCTCGGCCTCCCATTGTTAGG + Intronic
1089632025 11:119789803-119789825 CACTTTGGCCTCCTATCTGTGGG + Intergenic
1089761832 11:120732379-120732401 CGCCTTGGCCTCCCAAAGCTGGG + Intronic
1090983504 11:131745372-131745394 CACTTTGGCCTCATCTTGCAAGG - Intronic
1091454514 12:596806-596828 CACCTCAGCCTCCTGTAGCTGGG - Intronic
1091499833 12:1005389-1005411 CACCTTGGCCTCCGAGTGTTGGG + Intronic
1091751624 12:3025190-3025212 CACCTCAGCCTCCCAGTGCTGGG + Intronic
1092146343 12:6217271-6217293 CACCTTGGCCTCCCAAAGCTTGG - Intronic
1092221222 12:6715327-6715349 CACCTCGTCCTCCCAGTGCTGGG + Intergenic
1092291782 12:7163657-7163679 CACAGAGGCCTCCTTTTGCTGGG + Intergenic
1092459683 12:8675109-8675131 CACTTTGGCCTCAAAATGCTGGG + Intergenic
1092777925 12:11960292-11960314 CGCCTCGGCCTCCCAGTGCTGGG - Intergenic
1093015147 12:14147926-14147948 CACCTTGGACTCCTTGTGTTTGG + Intergenic
1093955766 12:25216521-25216543 CACCTTGGCCTCCTAAGGGCTGG + Intronic
1094563055 12:31574007-31574029 CACCTTGGCCTCCCACTGTTGGG - Intronic
1094611235 12:31997588-31997610 CGCCTCGGCCTCCTAGTGCTGGG + Intergenic
1096144749 12:49270730-49270752 CACCTTGGCCTCCCAGTGCTGGG - Intronic
1096195628 12:49647273-49647295 CACCTTGGCATCCAGTTTCTTGG + Exonic
1096738447 12:53674696-53674718 CACCTTGGCCTCCCAGTGTTGGG + Intronic
1097006049 12:55918617-55918639 CGCCTTGGCCTCCCAGTGCTGGG - Intronic
1097080572 12:56427822-56427844 CACCTTGGCCTCCTCAAGCGCGG + Intronic
1098718999 12:73870721-73870743 CACCTTAGCCTCACAGTGCTGGG - Intergenic
1098887260 12:75972945-75972967 CACCTTGGCCTCCCAGTGTTTGG + Intergenic
1098970400 12:76849033-76849055 CACCTCGGCTTCCAAGTGCTGGG - Intronic
1100258183 12:92905347-92905369 CGCCTTGGCCTCCCATTGTTGGG - Intronic
1100440437 12:94612247-94612269 TGCCTTGGCCTCCTAAAGCTGGG + Intronic
1100531483 12:95465727-95465749 CACCTCGGCCTCCAAGTACTGGG - Intergenic
1100575696 12:95889985-95890007 CACCATGGCCTCGATTTGCTGGG + Intronic
1101156354 12:101931300-101931322 CACGCTGGCCTCCAATTCCTTGG + Intronic
1101176888 12:102161354-102161376 TGCCTTGGCCTCCTAGTGGTGGG + Intronic
1101230183 12:102732756-102732778 CGCCTCGGCCTCCCAGTGCTGGG - Intergenic
1101707235 12:107231897-107231919 CTGCTTGACCTCCTATTTCTGGG + Intergenic
1101912071 12:108867386-108867408 CACCTTGGCCTCCCAGTGCTGGG - Intronic
1102106788 12:110331584-110331606 CACCTTGGCCTCTCAGTGCTGGG + Intronic
1102109714 12:110355827-110355849 TGCCTTGGCCTCCCAGTGCTGGG - Intergenic
1102333012 12:112051457-112051479 CACCTCGGCCTCCCAGTGCTTGG + Intronic
1102474851 12:113181901-113181923 CACCTCAGCCTCCCAGTGCTGGG - Intronic
1102479232 12:113209632-113209654 CACCTTAGCCTCCCAGTGCTGGG + Intronic
1102673369 12:114638800-114638822 CGCCTCGGCCTCCCAATGCTGGG + Intergenic
1102854539 12:116281757-116281779 CACCTTGTCCTCCCAGTTCTAGG - Intergenic
1102991466 12:117319299-117319321 TGCCTTGGCCTCCCAGTGCTGGG + Intronic
1103293246 12:119864582-119864604 CACCTCGGCCTCCCAGTGCTGGG + Intronic
1103433718 12:120908307-120908329 CACCTGGGGCTGCTATAGCTTGG - Intergenic
1103576442 12:121881039-121881061 CACCTTGGCCTCCCAGTGTTGGG + Intergenic
1104026664 12:125032517-125032539 TGCCTTGGCCTCCCAGTGCTGGG - Intergenic
1104835778 12:131789406-131789428 TATCTTGGCCTCCAAGTGCTGGG - Intronic
1104865600 12:131951429-131951451 CGCCTTGGCCTCCTAGTGCTGGG + Intronic
1105470741 13:20692478-20692500 CACCTTGGCCTCCCAGAGCTGGG + Intergenic
1105585347 13:21738112-21738134 CCCCTTCTCCTCCTATTTCTGGG - Intergenic
1106186026 13:27410798-27410820 CACCTTGGCCTCCCAAAGCACGG + Intergenic
1106530553 13:30586731-30586753 CACCTTGGCCTCCCAAAGGTTGG + Intronic
1106656983 13:31756867-31756889 CACCTCGGCCTCAAAGTGCTGGG + Intronic
1107081305 13:36377641-36377663 CACCTTGGCTTCCCAGTGTTGGG + Intergenic
1107512939 13:41103228-41103250 CACCTCAGCCTCCTGTAGCTGGG - Intergenic
1107978687 13:45714038-45714060 CACCTTGGCCTCCTCCTCCCCGG - Exonic
1109386071 13:61630379-61630401 CACCTAGGCCTCAAAGTGCTGGG - Intergenic
1109885334 13:68534790-68534812 CACCTTGGCCTCCCAAAGCTGGG - Intergenic
1110117848 13:71842324-71842346 CACTTTGGCTTCCCAGTGCTGGG - Intronic
1111112636 13:83734324-83734346 CACCTAGGCTTCCCAGTGCTGGG - Intergenic
1111934676 13:94546929-94546951 CACAGTGGCCTGCTAGTGCTTGG - Intergenic
1112025624 13:95408355-95408377 CACCTCAGCCTCCCATAGCTGGG + Intergenic
1112247628 13:97748977-97748999 CACAGTGGCCTGCTAGTGCTTGG - Intergenic
1112308510 13:98296931-98296953 TACCTTGGCCTCCCAAAGCTGGG + Intronic
1112322270 13:98418521-98418543 CGCCTTGGCCTCCCAGTGTTGGG + Intronic
1112468662 13:99668334-99668356 TGCCTTGGCCTCCCAGTGCTGGG - Intronic
1113827169 13:113265298-113265320 CACCTTGCCCTCCCATAGCTGGG - Intronic
1114191797 14:20445049-20445071 CGCCTTGGCCTCCCAGTGCTGGG + Intergenic
1114283142 14:21213069-21213091 CTCCTCCTCCTCCTATTGCTCGG - Exonic
1115103577 14:29733348-29733370 CACCTCGGCCTCCAAGTGCTGGG + Intronic
1115639292 14:35322227-35322249 CCCCTTGGCCTCCCAGTGCCAGG - Intergenic
1115684075 14:35776131-35776153 CACCTTGGCCTCCCAAAGTTGGG - Intronic
1116927534 14:50655795-50655817 CACCTCGGCCCCCCAGTGCTGGG - Intronic
1116971510 14:51071126-51071148 CACCCTGGCCTCAAAGTGCTAGG - Intronic
1117145899 14:52836629-52836651 CGCCTCGGCCTCCCAGTGCTGGG - Intergenic
1117850673 14:59965633-59965655 CACCTCGGCCTCCCAGTGCTGGG - Intronic
1117903364 14:60558971-60558993 CACCTTGGCCTCCCAGTGTTGGG - Intergenic
1118072799 14:62264298-62264320 CGCCTTGGCCTCCCAGTGCTGGG + Intergenic
1118222339 14:63866721-63866743 TGCCTTGGCCTCCAAGTGCTGGG - Intronic
1119815220 14:77560335-77560357 CACCTTGGCCTCCCAGTACTGGG - Intronic
1120610497 14:86635699-86635721 CACCTTGGCCTCCCAAAGCTCGG - Intergenic
1120836873 14:89047010-89047032 CACCTCGGCCTCAAAGTGCTGGG - Intergenic
1120875375 14:89370550-89370572 AACCTTGGCTTCCGCTTGCTGGG - Intronic
1121798467 14:96754642-96754664 CACCTTGGCCTCCTAAAGTGCGG + Intergenic
1122731199 14:103799795-103799817 CACCTTGGCCTCCCAAATCTGGG - Intronic
1123430585 15:20212268-20212290 CACCATGGCCTCAAATTCCTGGG + Intergenic
1123700388 15:22910408-22910430 CACCTTGGCCTCCCAGTGTTGGG + Intronic
1123917530 15:25047730-25047752 CACCATGGCCTCCCACTGCTGGG + Intergenic
1125445944 15:39756477-39756499 CACCTCAGCCTCCTGATGCTTGG + Intronic
1125660171 15:41387863-41387885 CACCTTGGCCTCCCAGTGTTGGG - Intronic
1125669145 15:41457283-41457305 CACCTCGGCCTCCCAGTGCTGGG - Intronic
1125755645 15:42062774-42062796 CACCTTGGCTTCCTTGTGCTGGG - Intergenic
1125997597 15:44178742-44178764 CGCCTTGGCCTCCCAGTGCTGGG - Intronic
1126594041 15:50368327-50368349 CACCTCGGCCTCCTAGTGCTGGG - Intergenic
1127079442 15:55362789-55362811 CACCTTGGCCTCAAAATACTGGG - Intronic
1127201336 15:56655453-56655475 CACCTCGGCCTCCCAGTGCTGGG + Intronic
1127913497 15:63437230-63437252 CCCCTTGGTGTCCTATTACTGGG - Intergenic
1129226037 15:74170994-74171016 AAGCTTGGCCTCCTAGTTCTGGG + Intergenic
1129359663 15:75016874-75016896 CACCTTTGGCTCAGATTGCTAGG + Intronic
1129449343 15:75641572-75641594 CACCTTGGCCTCCCAGTGTTGGG - Intronic
1129505368 15:76077212-76077234 CACCTTGGCCTCCCAAAGTTCGG + Intronic
1129526581 15:76220314-76220336 CACCTTGGCCTCCCAGTGCTGGG + Intronic
1129912133 15:79236720-79236742 CTCCTCCTCCTCCTATTGCTTGG + Intergenic
1130009276 15:80135873-80135895 CACCTTGGCCTCCCAGTGCTGGG - Intronic
1130418143 15:83713906-83713928 CACCTTTGCCTGCTCATGCTTGG + Intronic
1130706683 15:86239535-86239557 CACCTGGGCCTGACATTGCTGGG + Intronic
1132568144 16:632496-632518 CACCTGGGCCTCCCCTTGCAGGG + Intronic
1132595114 16:745677-745699 CACCTCGGCCCCCCAGTGCTGGG + Intronic
1132597030 16:757191-757213 CACCTTGACCTCCCAATGCTAGG - Intronic
1132837313 16:1960469-1960491 CACCTTGGCCCCCAGGTGCTGGG + Intronic
1133262226 16:4558363-4558385 CGCCTTGGCCTCCCAGTGTTGGG - Intronic
1133695664 16:8260172-8260194 CACCTTGCCTTCCTCTTGTTTGG - Intergenic
1133805254 16:9121803-9121825 CGCCTTGGCCTCCCAGTGCTGGG - Intergenic
1134068167 16:11243072-11243094 CTCCTCCTCCTCCTATTGCTCGG + Intergenic
1134151480 16:11808739-11808761 CGCCTTGGCCTCCCAGTGTTAGG - Intergenic
1135190398 16:20349497-20349519 CACCATAGCCTCCAATTCCTGGG + Intronic
1135292047 16:21248271-21248293 CACCTCAGCCTCCCAGTGCTGGG + Intronic
1136066605 16:27763065-27763087 TATCTTGGCCTCCCAATGCTGGG - Intronic
1136522324 16:30805218-30805240 CGCCTTGGCCTCCCAGTGCTGGG + Intergenic
1136911928 16:34150872-34150894 CTCCTGGGCCTCCAAGTGCTGGG + Intergenic
1137409662 16:48217345-48217367 CACCTTGGCCTCCCTGTGCCCGG - Intronic
1138091980 16:54182252-54182274 CGCCTTGGCCTCCCAGTGTTGGG + Intergenic
1139878587 16:70165786-70165808 CACCTTGGCCTCCCAGTGTTGGG - Intergenic
1140046412 16:71442746-71442768 CACCTGGGCCTGCTCTGGCTAGG - Intergenic
1140339329 16:74141513-74141535 CACCTCAGCCTCCTAGTGTTGGG - Intergenic
1140358973 16:74329028-74329050 CACCTTGGCCTCCCAGTGTTGGG + Intergenic
1140373925 16:74429706-74429728 CACCTTGGCCTCCCAGTGTTGGG + Intergenic
1140497195 16:75399625-75399647 TGCCTTGGCCTCCCAGTGCTGGG + Intronic
1140521264 16:75584114-75584136 CACCTTGGCTTCCTGTAACTTGG + Intergenic
1140714156 16:77706754-77706776 CACCTTGGTCACCTCGTGCTGGG + Intergenic
1141251536 16:82363417-82363439 CACAGTGGCCTGCTAGTGCTTGG + Intergenic
1142545869 17:702413-702435 CACCTCGGCCTCAAAGTGCTGGG - Intronic
1142570818 17:872867-872889 CGCCTTGGCCTCCCAGTGTTGGG + Intronic
1142821083 17:2467758-2467780 TACCTTGGCTTCCAATTGATTGG + Exonic
1142844210 17:2659580-2659602 TGCCTTGGCCTCCCAGTGCTGGG - Intronic
1142983261 17:3683480-3683502 CACCTCGGCCTCCCAGTGCTGGG - Intronic
1143577939 17:7805600-7805622 CACCTTGCCCTCCCAAAGCTTGG - Intronic
1143789121 17:9279335-9279357 CACCTTAGCCTCCCAGTGTTGGG + Intronic
1144924059 17:18788086-18788108 CGCCTCGGCCTCCCATTGCTGGG - Intronic
1145856690 17:28165964-28165986 CACCTCAGCCTCCCAGTGCTGGG - Intronic
1145885532 17:28380154-28380176 CACCTTGGCCTCCATGTGCCAGG + Intronic
1146197808 17:30827975-30827997 CACTTTGGCCTCCAAGTGTTGGG + Intergenic
1146707137 17:35009013-35009035 CACCTTGGCCTCCTAAAGTGTGG + Exonic
1146715600 17:35084343-35084365 CGCCTTGGCCTCCCAATGTTGGG - Intronic
1146756636 17:35437989-35438011 TGCCTTAGCCTCCCATTGCTGGG - Exonic
1146888936 17:36492395-36492417 CACCTTGGCCTCCGAATGTTAGG + Intronic
1146964367 17:37012301-37012323 TGCCTTGGCCTCCCAGTGCTAGG + Intronic
1147028575 17:37610381-37610403 CACCTCGGCCTCCAAGTGCCAGG + Exonic
1147154707 17:38538168-38538190 CACCTCAGCCTCCCAGTGCTGGG - Intronic
1147752765 17:42746429-42746451 CACCTCTGCCTCCCAGTGCTGGG + Intergenic
1147781797 17:42948428-42948450 CACTTTGGCCTCCCAGTGTTGGG - Intergenic
1148017074 17:44529347-44529369 CACCTTGGCCTCTCCGTGCTGGG + Intergenic
1148252140 17:46092066-46092088 CACCTTGGACTCCCATGCCTCGG + Intronic
1148368836 17:47078311-47078333 CACCTTGCCCTCCCATGCCTCGG + Intergenic
1148375055 17:47135890-47135912 CACTTTGGCCTCCCAGTGCTGGG - Intronic
1148593845 17:48837007-48837029 TGCCTTGGCCTCCCAGTGCTGGG + Intronic
1148671907 17:49416981-49417003 CACCTTGGCCTCAAAGTGCTGGG - Intronic
1148919349 17:51016656-51016678 CGCCTTGGCCTCCCAGTGCTGGG - Intronic
1149122668 17:53189123-53189145 CACCTCGGCCTCCCAGTGCTGGG - Intergenic
1149814873 17:59713790-59713812 CACCTTGGCCTCTCAGTGTTGGG - Intronic
1150061459 17:62072213-62072235 CGCCTTGGCCTCCCAGTGTTGGG + Intergenic
1150136688 17:62699654-62699676 CACCTCTGCCTCCCAGTGCTGGG + Intergenic
1150681350 17:67287038-67287060 CACCTTGGCCTCCCAGTGTTGGG - Intergenic
1150772455 17:68053085-68053107 CACCGTGGCCTCAAAGTGCTGGG + Intergenic
1151310267 17:73288505-73288527 CACCTCGGCCTCCCAGTGCTGGG + Intronic
1151325636 17:73378348-73378370 CACCTTGGCCTCCTAAAGTGCGG + Intronic
1151628251 17:75291444-75291466 CACCTCAGCCTCCCAGTGCTGGG - Intergenic
1151754149 17:76062034-76062056 CACCTCGGCCTCCCAGTGTTGGG - Intronic
1151761786 17:76108260-76108282 CACCTCAGCCTCCTGTAGCTGGG + Intronic
1151891445 17:76953058-76953080 CACCTCGGCCTCCCAGTGCTAGG + Intergenic
1152181729 17:78826277-78826299 TGCCTTGGCCTCTTAGTGCTGGG - Intronic
1152183906 17:78842038-78842060 CACCTTGGCCTCCAAGTGTTGGG - Intergenic
1152405236 17:80094462-80094484 CACCTTGGCCTCCCAAAGCTGGG - Intronic
1152495155 17:80665791-80665813 CACTTTGGCCTCCCACAGCTGGG + Intronic
1152778191 17:82214914-82214936 CACCTTGGCCTCAGGTAGCTGGG - Intergenic
1152778443 17:82215996-82216018 CACCTTGGCCTCAGGTAGCTGGG + Intergenic
1153569108 18:6450730-6450752 CACCTCAGCCTCCTATAGTTAGG - Intergenic
1153860707 18:9202074-9202096 CACCTCAGCCTCCCAGTGCTGGG + Intronic
1154402723 18:14057042-14057064 CTCCTTTGCCTCTTATTGCTTGG - Intergenic
1155280214 18:24231536-24231558 CACTTTGGCCTCAAAGTGCTAGG + Intronic
1155974876 18:32118283-32118305 CACCTTGGCCTCCCAAAGCTGGG - Intronic
1156205701 18:34883423-34883445 CACCTCAGCCTCCTGTAGCTGGG + Intronic
1156254719 18:35383999-35384021 CCCCTTGGCCTTCTTTTCCTTGG + Intergenic
1156369890 18:36463742-36463764 CGCCTTAGCCTCCCAGTGCTGGG + Intronic
1156410747 18:36826273-36826295 CACCTTGGCCTCCCAGTGTTGGG + Intronic
1156588680 18:38461373-38461395 AACATTGGCCTCTTATTGATTGG - Intergenic
1157259880 18:46168504-46168526 CACCTCGGCCTCCCAGTGTTGGG - Intergenic
1157844308 18:50988755-50988777 TGCCTTGGCCTCCAAATGCTGGG - Intronic
1157870235 18:51223466-51223488 CGCCTTGGCTTCCCAGTGCTGGG - Intergenic
1158350833 18:56563215-56563237 CACCTTGGACTCCAATGTCTGGG + Intergenic
1158897531 18:61929034-61929056 CACCTCAGCCTCCCAGTGCTGGG - Intergenic
1160177510 18:76607843-76607865 CACCTTGGCCTCCCAATGTGTGG - Intergenic
1160598357 18:79993415-79993437 CAGCTTGGGCTCCTATCACTAGG + Intronic
1160709281 19:543594-543616 CACCTCGGCCTCCCAGTGCTGGG - Intergenic
1160836843 19:1128718-1128740 CACCTTGGCCTCCAAGTGCTGGG - Intronic
1161095425 19:2387629-2387651 CACCTCAGCCTCCCATAGCTGGG - Intergenic
1161673432 19:5627462-5627484 TGCCTGAGCCTCCTATTGCTTGG + Intronic
1161760084 19:6164677-6164699 CACCTCAGCCTCCCAGTGCTGGG + Intronic
1161817415 19:6508179-6508201 CACCTTGGCCTCCCAGTGCTGGG + Intergenic
1162297401 19:9822746-9822768 CACCTTGGTCTCCCAGTGTTGGG + Intronic
1162423916 19:10582498-10582520 TCCCTTGGCCTCCCATTGTTGGG - Intronic
1162686753 19:12393095-12393117 CATCTTAGCCTACTATTGATGGG - Intronic
1162691105 19:12432869-12432891 CATCTTAGCCTACTATTGATGGG - Intronic
1162766982 19:12925604-12925626 CACCTCGGCCTCCCAGTGTTGGG + Intronic
1162945001 19:14037732-14037754 CCCCTTGGCCTCCCAGTGTTGGG - Intronic
1162988137 19:14285056-14285078 CGCCTCGGCCTCCAAGTGCTGGG + Intergenic
1163174970 19:15557968-15557990 CACCTTGGCCTCCCAGTGCTGGG + Intergenic
1163256896 19:16161426-16161448 CACCCCGCCCTCCTATAGCTCGG + Exonic
1163450214 19:17372812-17372834 CGCCTTGGCCTCCCAGTGCTGGG - Intronic
1163452107 19:17384400-17384422 CGCCTCGGCCTCCAAGTGCTGGG - Intergenic
1163719692 19:18893288-18893310 CCCCTTGGCCTCCAACTCCTGGG + Intronic
1163954764 19:20626780-20626802 CACCTTGGCCTCCTAATTTGAGG + Intronic
1164104760 19:22099831-22099853 CGCCTCGGCCTCCTAATGCTGGG - Intergenic
1164284403 19:23800288-23800310 CGCCTTGGCCTCCCAAAGCTGGG + Intronic
1164612246 19:29640426-29640448 CACCGTGGCCTGCTAGCGCTTGG + Intergenic
1165048789 19:33127964-33127986 CACCTTGGCCTCTGAGTGCCAGG + Intronic
1165396689 19:35568264-35568286 CGCCTCAGCCTCCTAGTGCTGGG - Intergenic
1165747491 19:38238656-38238678 CACCTCAGCCTCCCAGTGCTGGG - Intergenic
1165790365 19:38487880-38487902 CACCTTGGCCTCCCAGTGTTAGG + Intronic
1165835981 19:38756361-38756383 CACCTTGGCCTCAAAGTGCTGGG - Intronic
1165852403 19:38857299-38857321 CACCTCGGCCTCCCAGTGCTGGG - Intergenic
1166181307 19:41111132-41111154 CACCTCAGCCTCCTATAGCTAGG + Intergenic
1166199737 19:41229197-41229219 CACCTCGGCCTCCTAAGGCTGGG + Intronic
1166567516 19:43774246-43774268 CACCCTGGCCGCCTGCTGCTCGG - Exonic
1166665037 19:44674416-44674438 CACCTTGGCCTCCCAGTGCTGGG + Intronic
1166739371 19:45104778-45104800 CACCTTGCCATGCTCTTGCTGGG + Intronic
1166758304 19:45208501-45208523 CACCTGGGCCTCAAAGTGCTGGG - Intronic
1166848607 19:45746213-45746235 CACCTTGGCCTCCCAAAGTTCGG + Intronic
1167188321 19:47964195-47964217 CGCCTTGGCCTCCCAGTGTTGGG + Intergenic
1167322023 19:48802944-48802966 CACCTTAGCCTCCCAGTTCTGGG - Intronic
1167553747 19:50179567-50179589 CACCTTGGCCTCCTAAAGTGTGG - Intergenic
1167952771 19:53040636-53040658 CACCTTGGCCTCCAAATTGTTGG - Intergenic
1168382260 19:55933774-55933796 CACCTTGGCCTCCTAAAACTAGG - Intergenic
1168632150 19:57965495-57965517 TACCTTGGCCTCCCAGTGCTGGG - Intronic
924959986 2:26236-26258 TCCCTTTGCCTCCTATTTCTAGG - Intergenic
925091634 2:1161167-1161189 CGCCTTGGCCCCGTAGTGCTGGG - Intronic
926024046 2:9524374-9524396 CACCTCAGCCTCCTCTAGCTGGG - Intronic
927558959 2:24055456-24055478 CACCTTGGCCTCCTAGTGCTGGG + Intronic
927826450 2:26312985-26313007 CACCTTGGCCACGTATTTCATGG + Exonic
927950254 2:27163181-27163203 CACCCTGTCTTCCTATTACTAGG - Intergenic
928057747 2:28074976-28074998 CAACTTGCCCTCCTTTTTCTTGG - Intronic
928082257 2:28321811-28321833 CACCTTTGCCTCTCACTGCTTGG + Intronic
928155006 2:28868762-28868784 CACCTCGGCCTCCCAGTGCTGGG - Intronic
928339678 2:30431717-30431739 CACCTTGGCCTCCTAAGTGTTGG - Intergenic
929195565 2:39180935-39180957 CACCTCGGCCTCCCAGTGCTGGG + Intronic
929243415 2:39676032-39676054 CACCTTGGCCTTCCAGTGTTGGG + Intronic
929393729 2:41498777-41498799 CACCTCGGCCTCTCAGTGCTGGG + Intergenic
929525050 2:42693824-42693846 CACCATAGCCACCTATAGCTGGG + Intronic
930238594 2:48911834-48911856 CACCTTGGCCTCCCAGTGCTGGG - Intergenic
930367127 2:50454075-50454097 CACCTCGGCCTCAAAGTGCTGGG - Intronic
930639198 2:53838107-53838129 CACCTTGGCATCCCAGTGTTGGG - Intergenic
930715927 2:54594077-54594099 CACCTCGGCCTCCCAAAGCTGGG + Intronic
930782297 2:55234448-55234470 CACCGTGGCCTCCCAGCGCTGGG + Intronic
931353461 2:61513247-61513269 TGCCTTGGCCTCCCAGTGCTGGG + Intronic
931462324 2:62459884-62459906 CACCTTGGCCTCCAAGTAGTTGG + Intergenic
931512780 2:63019458-63019480 CGCCTGGGCCTCCCAGTGCTGGG - Intronic
931926080 2:67074065-67074087 TATCTTGGCTCCCTATTGCTTGG + Intergenic
932275245 2:70446641-70446663 CACCTTGGCCTCAGAGTTCTGGG - Intergenic
932282309 2:70504161-70504183 CACCTCGGCCTCCCAGTGTTGGG - Intronic
932427952 2:71654975-71654997 CACCTTAGCCTCCTGTAGCTGGG - Intronic
932629539 2:73327441-73327463 CACCTCAGCCTCCTGTAGCTGGG + Intergenic
933264636 2:80168987-80169009 CACTTTGGCCTCCCCTGGCTGGG + Intronic
933669765 2:84995700-84995722 CAACTTGGCCTCCCAGTGTTGGG - Intronic
933747626 2:85582583-85582605 CTCCTTGGCATCCCATGGCTGGG + Intergenic
934679793 2:96275254-96275276 CACCTTGGCCTTCTGCTGCAAGG + Exonic
935002518 2:99033590-99033612 CACCTCAGCCTCCCAGTGCTGGG - Intronic
935186456 2:100738251-100738273 CACCACGGCCTCCAATTCCTGGG - Intergenic
936087860 2:109481496-109481518 CTCCTCGGCCTGTTATTGCTCGG + Intronic
936116085 2:109704297-109704319 CACCTCGGCCTCCCAGTGTTAGG - Intergenic
936956345 2:118026438-118026460 CACCTTGGACACCTGTTGTTAGG - Intergenic
937001577 2:118472472-118472494 CGCCTCGGCCTCCCAATGCTGGG + Intergenic
937043764 2:118840051-118840073 CACCTTCTCCTCCTCTCGCTGGG + Intergenic
937303934 2:120859701-120859723 CGCCTTGGCCTCCTAAAGTTTGG + Intronic
937419680 2:121743329-121743351 CACCTTGGCCTCCCAGTGTTGGG + Intronic
937444847 2:121949247-121949269 CGCCTGGGCCTCCCAGTGCTGGG + Intergenic
938593937 2:132767492-132767514 CGCCTTGGCCTCCTAGTGCTGGG + Intronic
938820223 2:134950040-134950062 CACCTTGGCCTCAAAGTGTTAGG + Intronic
938893280 2:135726721-135726743 CGCCTCGGCCTCCCAGTGCTGGG - Intergenic
939008356 2:136816131-136816153 CACCTTGGCCTCCAAGTGCTGGG + Intronic
939674566 2:145056074-145056096 CACCTTAGCCTCAAAGTGCTGGG - Intergenic
940265391 2:151830460-151830482 CACCTTGGCCTCCCAGTGTTGGG - Intergenic
941551880 2:166926958-166926980 CACCTTTGCCTCCCATTCCCAGG - Intronic
942897098 2:181070272-181070294 CTCCTCAGCCTCCTAATGCTGGG - Intronic
943145879 2:184044277-184044299 CACCTCAGCCTCCTATAGCTGGG + Intergenic
943548593 2:189311452-189311474 CAGCAGGGCCTCCTATTCCTGGG + Intergenic
943601257 2:189923727-189923749 CTCCTCCTCCTCCTATTGCTCGG + Intronic
943666929 2:190618825-190618847 TGCCTTGGCCTCCCAGTGCTGGG + Intergenic
945365928 2:208953527-208953549 CGCCTCGGCCTCCAAGTGCTGGG + Intergenic
945420172 2:209626165-209626187 CACCTTGGCCTCAAAGTGCTGGG - Intronic
946018097 2:216620361-216620383 CACCTCGGCCTCAAAGTGCTGGG - Intergenic
946259768 2:218478116-218478138 CACTCTGGCCTCTTATTTCTTGG - Intronic
946358557 2:219204998-219205020 CACCTTGGCCTCCGAGGGATGGG + Intronic
946863431 2:224021773-224021795 CACCTTGGCCTCTTAAAGTTGGG - Intronic
947314376 2:228839531-228839553 AACCTTGGCCTCCTGTTCCTGGG - Intergenic
948145306 2:235703923-235703945 CCCCTTGGCCTCCAAGTACTGGG + Intronic
948179965 2:235972025-235972047 CACCTCAGCCTCCCAGTGCTGGG + Intronic
1169102248 20:2960495-2960517 CACCTCGGCCTCCCAAAGCTGGG + Intronic
1169160916 20:3377706-3377728 CACCTTGGCCTTGAAGTGCTAGG + Intronic
1169359805 20:4938573-4938595 CACCTTGGCCTCCCAATGCTGGG + Intronic
1169377776 20:5080788-5080810 CACCTTGGCCTCCCAAAGCTGGG + Intronic
1170443846 20:16405113-16405135 GACCTTGGCCTTCTAGGGCTGGG + Intronic
1170852346 20:20016893-20016915 CGCCTTGGCCTCCCAGTGTTGGG + Intergenic
1171477475 20:25423360-25423382 CACCTTGGTCTCCCAAAGCTGGG + Intronic
1172150927 20:32789840-32789862 CGCCTCGGCCTCCCAGTGCTGGG + Intronic
1172157783 20:32841062-32841084 TGCCTTGGCCTCCCAGTGCTGGG + Intronic
1172339432 20:34144602-34144624 TGCCTTGGCCTCCCAGTGCTGGG - Intergenic
1172399109 20:34633815-34633837 CGCCTTGGCCTCCAAGTGCTGGG + Intronic
1172697915 20:36835216-36835238 GACCTTGCCCTCCTCATGCTGGG + Intronic
1173113040 20:40213348-40213370 CACCTTGGCCTCCCAAAGCGTGG - Intergenic
1174436875 20:50514612-50514634 CACCTTGGCCTCCTGAAGTTGGG + Intronic
1174575569 20:51534581-51534603 CACCTCGGCCTCCCAGTGCTGGG + Intronic
1174600506 20:51720583-51720605 CACCTTGACCTCCCAAAGCTGGG - Intronic
1175099349 20:56567449-56567471 CACCTCGGCCTCCCAGTGTTGGG + Intergenic
1175346486 20:58281094-58281116 CACCTTGGCCTCCCAAAGCTGGG - Intergenic
1175510577 20:59521846-59521868 CACCTTGGCCTCCCAAAGCTGGG - Intergenic
1177633169 21:23752568-23752590 CACTTTGGGCTCCTTTTTCTAGG - Intergenic
1178621223 21:34178293-34178315 CACCTTTGCATCCTACTGCTTGG + Intergenic
1178985980 21:37303515-37303537 CACCTTGGCCTCCTGAAGCTGGG + Intergenic
1180057090 21:45364639-45364661 CCCCCTGGCCTCCTGGTGCTTGG - Intergenic
1180900677 22:19369681-19369703 CACCTCGGCCTCCCAGTGTTGGG - Intronic
1181290359 22:21787737-21787759 CACCTTGGCCTCCCAAAACTGGG - Intronic
1181646131 22:24232594-24232616 CACCTTGGAGTCCTATCACTTGG + Intronic
1182176241 22:28292434-28292456 CACCTCGGCCTCCAACTCCTGGG + Intronic
1182197887 22:28537880-28537902 CACCTCAGCCTCCCATAGCTGGG - Intronic
1182323236 22:29491926-29491948 CACCCTGGCCTCCCAAAGCTGGG - Intergenic
1182455666 22:30448620-30448642 TACCTTGGCCTCCCAGTGCTAGG - Intronic
1182896513 22:33863507-33863529 CACCTCGGCCTCCCAGTGTTGGG - Intronic
1183439187 22:37813590-37813612 CACCTGGGCCTCCTGCAGCTTGG - Exonic
1183450198 22:37889848-37889870 CGCCTCGGCCTCCCAGTGCTGGG - Intergenic
1183941598 22:41298747-41298769 CACCTCGGCCTCCTAGTGTTGGG + Intergenic
1184333377 22:43839886-43839908 GACCTTGGGCTCCTCTTGGTGGG + Intronic
1184711638 22:46253820-46253842 TACCTTGGCCTCCCAGTGCTGGG - Intergenic
1185001018 22:48245840-48245862 CGCCTCAGCCTCCTACTGCTGGG - Intergenic
950777874 3:15365907-15365929 CGCCTTGGCCTCCCAGTACTGGG - Intergenic
951380467 3:21977758-21977780 CACCGTAACCTCCAATTGCTGGG - Intronic
951406373 3:22304024-22304046 CACCTCGGCCTCCCAGTGTTGGG + Intronic
951559659 3:23953086-23953108 CACCTTGGCCTCCCAGTGCTGGG - Intronic
951885340 3:27518836-27518858 AGCCTTGGCCTCCAAGTGCTAGG - Intergenic
951886990 3:27534051-27534073 CAGCTTGGCCTCCTGGTGATGGG + Intergenic
951920073 3:27844781-27844803 CAACTTGGCCCACTATTTCTTGG + Intergenic
951965674 3:28381912-28381934 CACCTTGGCCTCCTATTGCTGGG - Intronic
952737623 3:36706014-36706036 CACCTCGGCCTCAAAGTGCTGGG + Intergenic
953014260 3:39057867-39057889 CGCCTTGGCCTCCCAAAGCTGGG + Intronic
953792401 3:45958405-45958427 GACCTTGGCCTCCTGTGGCCTGG + Exonic
953794521 3:45974166-45974188 CAGCTTGGCCTCAAATTCCTGGG - Intronic
953991226 3:47484969-47484991 CGCCTTGGCCTCCCAGTGTTGGG + Intergenic
953991554 3:47487851-47487873 TACCTCGGCCTCCCAGTGCTGGG + Intergenic
954058051 3:48044512-48044534 CACCTCGGCCTCCCAGTGCTGGG - Intronic
954791656 3:53137580-53137602 CACCTTGGCCTCCCAGTGTTGGG - Intergenic
954852307 3:53614041-53614063 CACCTTGGCCTCCTAGTAGCTGG - Intronic
955194870 3:56795884-56795906 CACCTCAGCCTCCAAGTGCTAGG + Intronic
955229030 3:57082927-57082949 CACCTTGGCCTCCCAAAGCGGGG + Intergenic
955384639 3:58469854-58469876 CACCTTGGCATCCCAGTGCTGGG + Intergenic
956649136 3:71487306-71487328 CACCTTGGCTTCCCAGTGTTGGG + Intronic
956845528 3:73178768-73178790 TGCCCTGGCCTCTTATTGCTGGG - Intergenic
956858719 3:73301431-73301453 CACCTGAGCCTCCCAGTGCTGGG + Intergenic
957062880 3:75496363-75496385 TGCCTTGGCCTCCTAGTGTTGGG + Intergenic
957275053 3:78080496-78080518 CACGGTGGCCTACTAGTGCTTGG - Intergenic
957337555 3:78851056-78851078 CACCTCGGCCTCCCAAAGCTGGG + Intronic
957504271 3:81099561-81099583 CTCCTTGGCCTCCCAGTGTTGGG - Intergenic
958863619 3:99473606-99473628 TACCTAGGCATCATATTGCTTGG + Intergenic
959064296 3:101641332-101641354 CCCCTTCTCCTCCTATTGTTAGG + Intergenic
959293770 3:104509179-104509201 CACCTCAGCCTCCTAGTGTTGGG - Intergenic
959465745 3:106684646-106684668 CACCTCGGCCTCCCAAAGCTGGG - Intergenic
960805788 3:121582817-121582839 CACCTCAGCCTCCCATAGCTGGG + Intronic
960923244 3:122769927-122769949 CACCTGGGCCTCAAAGTGCTGGG + Intronic
961030801 3:123601862-123601884 CGCCTTGGCCTCTCAGTGCTGGG + Intergenic
961139060 3:124540167-124540189 CACCTTGGCTTCCCAGTGCTAGG + Intronic
961290510 3:125843067-125843089 CGCCTTGGCCTCCCAGTGTTGGG - Intergenic
961884742 3:130089169-130089191 CAGCTTGCCCTCCTACTGCCTGG - Intronic
962353991 3:134678073-134678095 CACCTGGGCCACCTGGTGCTGGG + Intronic
962746586 3:138401528-138401550 CACCTTTGCCTCTGAGTGCTGGG - Intronic
963140569 3:141943005-141943027 CACCTCGGCCTCCCAGTGTTGGG + Intergenic
964313438 3:155418513-155418535 GACGTTGGCCTCCCATTCCTGGG - Intronic
965205483 3:165715241-165715263 CACCTAGGCCTCCCAAAGCTGGG + Intergenic
965486492 3:169284747-169284769 CACCTTTGACTCCTAGTGATGGG - Intronic
966005316 3:175004123-175004145 TGCCTTGGCCTCCCAGTGCTGGG - Intronic
966174102 3:177116386-177116408 CACCATGACCTTCTATTTCTAGG + Intronic
966276184 3:178172870-178172892 CACCTCAGCCTCCCAGTGCTGGG - Intergenic
966794592 3:183701333-183701355 TGCCTTGGCCTCCCAGTGCTGGG + Intronic
966844894 3:184120890-184120912 CATCTTGGCCTCCCATAGCGTGG - Intergenic
968203726 3:196779917-196779939 CACCTTGGCCTCCTAAAGTGTGG + Intronic
968328852 3:197846150-197846172 CACCGAGGCCTCCGAGTGCTGGG - Intronic
968643487 4:1726876-1726898 CGCCTCGGCCTCCCAGTGCTAGG - Intronic
968776888 4:2547498-2547520 CACCTTGGCTTCCCAGTGTTAGG + Intronic
969431066 4:7154608-7154630 CACCTTGGCTTCCTCGAGCTGGG + Intergenic
970395464 4:15660826-15660848 CACCTCGGCCTCCCAGTGTTGGG - Intronic
970423518 4:15926429-15926451 CACCTTGGCCTCCCAAAGCTGGG + Intergenic
971392047 4:26195118-26195140 CACCTTGACCTCCCAGTGTTGGG - Intronic
971816199 4:31493185-31493207 CACCTTGGCCTCCCAAAGTTTGG - Intergenic
971910385 4:32788693-32788715 CACCTTGGCCTCCCAAAGCTTGG - Intergenic
972573216 4:40329280-40329302 CACTGTGGCCTCCAATTCCTGGG - Intergenic
972629502 4:40831147-40831169 CACCTCGGCCTCCCAGTGCTGGG - Intronic
972706657 4:41551299-41551321 CAGCCTTGCCTTCTATTGCTAGG + Intronic
973676624 4:53269774-53269796 CGCCTTGGCCTCCCAGTGTTGGG - Intronic
973697178 4:53501531-53501553 CACTTTGGCCTCCAAGTGCTAGG + Intronic
973959838 4:56098921-56098943 CACCTTGGCCTCCTAAAATTTGG + Intergenic
974600432 4:64072756-64072778 CAACTTGTCTTCATATTGCTGGG - Intergenic
974625745 4:64427383-64427405 CACCTCGGCCTCCTGTAACTGGG + Intergenic
975779087 4:77820026-77820048 GGCCTTGGCCTCCTGGTGCTGGG + Intergenic
976195980 4:82531504-82531526 CACCTTGGCCTCCCAGTGTTGGG - Intronic
976296970 4:83482458-83482480 CACCTTGGCCTCCCAGTGCTAGG - Intronic
976598581 4:86917027-86917049 CACCTTGGCCTCCCAGTGTTGGG - Intronic
976721826 4:88176740-88176762 CGCCTTGGCCTCCTACTTCTGGG + Intronic
976782397 4:88775453-88775475 CACCTCAGCCTCCCAGTGCTGGG - Intronic
977087537 4:92621545-92621567 CACCTCAGCTTCCTATAGCTGGG - Intronic
977486536 4:97654410-97654432 CACCTTGGCTTATTATTTCTCGG - Intronic
977598832 4:98914107-98914129 CACCTCGGCCTCAAAGTGCTGGG - Intronic
977799357 4:101207576-101207598 CACCTCGGCCTCCCAGTGCTGGG - Intronic
978141339 4:105320686-105320708 CACCTCGGCCTCCCAGTGCTGGG + Intergenic
978441837 4:108741462-108741484 CGCCTCAGCCTCCTAGTGCTGGG - Intergenic
978443484 4:108758800-108758822 CGCCTCGGCCTCCCAGTGCTGGG - Intronic
978516724 4:109576759-109576781 AACCTTGGACTACTATTGATGGG + Intronic
978801327 4:112758148-112758170 CGCCTCGGCCTCCGAGTGCTGGG + Intergenic
978906926 4:114016199-114016221 TGCCTTGGCCTCCCAGTGCTGGG - Intergenic
980316210 4:131204313-131204335 CGCCTCGGCCTCCCATAGCTGGG - Intergenic
982476322 4:155855896-155855918 CAGCCGGGCCTCCTCTTGCTAGG + Intronic
982733141 4:158977860-158977882 CACCTCTGCCTCCCAGTGCTGGG + Intronic
982767392 4:159364705-159364727 CACCTTGGCTTCCCAGTGTTGGG - Intergenic
982833289 4:160090068-160090090 CACCTTGGCCTCCCAGTTCTGGG - Intergenic
982846460 4:160259183-160259205 CACCTCGGCCTCCCAATGCTGGG + Intergenic
983017883 4:162638028-162638050 CACCTTGGCTTCCCAGTGTTGGG + Intergenic
983265375 4:165502291-165502313 CACCTCAGCCTCCTGTAGCTAGG + Intergenic
984045865 4:174797682-174797704 CACCTTGGCCGCCCGGTGCTGGG - Intronic
984098275 4:175457774-175457796 CACCTTGGGCACATATTGTTGGG - Intergenic
984142070 4:176015525-176015547 CACCTTGGCCTCCCAGTGTTGGG + Intergenic
984686567 4:182675291-182675313 CACCTTGGCCTCCTGGTGCTGGG - Intronic
984788191 4:183588867-183588889 CACCTTGGCCTCCCAATGGGTGG - Intergenic
985158783 4:187021767-187021789 CACCTTGACTTCCTATTGTTTGG - Intergenic
986419668 5:7566236-7566258 TGCCTTGGCCTCCTAGTGTTGGG - Intronic
986924824 5:12733812-12733834 CACATTGGCCTCAAATTCCTGGG - Intergenic
987387430 5:17343266-17343288 CACCTTGGCCTCCCAAAGCATGG - Intergenic
988685507 5:33521653-33521675 CACCTCGGCCTTCAAGTGCTGGG + Intergenic
988919768 5:35929537-35929559 CACCTTGGCCTCACAATGCTGGG + Intronic
991047825 5:62241233-62241255 CACCATGGCCTCAAATTTCTGGG + Intergenic
991068890 5:62455269-62455291 CACCACGGCCTCCCAGTGCTGGG - Intronic
991301039 5:65129394-65129416 CACCTTGGCCTCCCAAAGTTTGG + Intergenic
991500754 5:67274298-67274320 CACCATGGTATCCTGTTGCTTGG - Intergenic
991979926 5:72220181-72220203 CACCTTGGCCTCATGTACCTGGG + Intronic
992810972 5:80388191-80388213 CACCTCAGCCTCCTGTAGCTAGG - Intergenic
992896434 5:81249329-81249351 CACCTTTGCCTCCCAGTGCTGGG + Intronic
993333056 5:86623525-86623547 CACCTCGGCCTCTGAGTGCTGGG - Intergenic
994169826 5:96646903-96646925 CACCTTCACCTCCTATCGTTTGG - Intronic
994687299 5:102971053-102971075 CGCCTTGGCTTCCCAGTGCTGGG + Intronic
995551869 5:113289574-113289596 CACCTTTACCTCCTCTTTCTCGG + Intronic
996173394 5:120324195-120324217 CGCCTCGGCCTCCCAGTGCTGGG - Intergenic
996441093 5:123491778-123491800 CTAGTTTGCCTCCTATTGCTAGG - Intergenic
996785991 5:127237244-127237266 CACCTTGGCCTCCCAGTGCTGGG - Intergenic
997161853 5:131617232-131617254 CAGATTGGCCTCCTACTTCTGGG - Intronic
997280162 5:132637780-132637802 CACCTTGGCCTCCCAGTGTTGGG + Intronic
997480753 5:134182902-134182924 TACCTTGGCCTCCCAACGCTGGG + Intronic
997774737 5:136592152-136592174 CACCTTGGCCTCCTAAAGTGTGG + Intergenic
998100256 5:139426966-139426988 CACCTTGGCCTCCAAAAGTTTGG + Intronic
998120182 5:139570005-139570027 CACCTTGGCCTCCCAGTGTTGGG - Intronic
998555939 5:143123740-143123762 CACCTCAGCCTCCCATAGCTAGG - Intronic
999260272 5:150234059-150234081 CGCCTTGGCCTCAAAGTGCTGGG + Intronic
999302741 5:150501254-150501276 CTCCTCTGCCTCCTCTTGCTGGG + Intronic
999673656 5:153978301-153978323 CACGTTGGCCTCCCAGTGTTGGG - Intergenic
999734270 5:154500962-154500984 CACCTCGGCCTCCCAGTGCTGGG - Intergenic
1000288511 5:159847991-159848013 CACCTCGGCCTCCCAATGTTGGG - Intergenic
1000320656 5:160132014-160132036 CACCTTGGCCTCAAAGTGCTGGG - Intergenic
1001660515 5:173388697-173388719 CACCTTGGCCTCCCAGTGTTGGG + Intergenic
1001819938 5:174702567-174702589 CACCTCAGCCTCCTGTAGCTGGG + Intergenic
1002027853 5:176407550-176407572 CACCTCAGCCTCCCACTGCTGGG + Intronic
1002124282 5:177030368-177030390 CGCCTCGGCCTCCCAGTGCTGGG - Intronic
1002172100 5:177380928-177380950 CACCTCAGCCTCCAAGTGCTGGG + Intronic
1002248689 5:177906957-177906979 CACCTGGGCCTACCAGTGCTAGG - Intergenic
1002494236 5:179600944-179600966 CACCTCAGCCTCCCAGTGCTGGG + Intronic
1002525949 5:179816394-179816416 CACCTCGGCCTCCCAGTGCTGGG + Intronic
1002906676 6:1454774-1454796 CACCTTGGCCTCAAAATGCCAGG - Intergenic
1003034159 6:2628515-2628537 CACCTCTTCCTCCTAGTGCTAGG - Intronic
1003104801 6:3207180-3207202 CACCTTGCCCTCCCAGTGTTGGG - Intergenic
1003678044 6:8225195-8225217 CACCTCAGCCTCCCATTGCTGGG + Intergenic
1003878951 6:10463121-10463143 CACCTTGGCTCCCAAGTGCTGGG - Intergenic
1004420516 6:15465335-15465357 CACCTCAGCCTCCTGTAGCTGGG - Intronic
1004467828 6:15902332-15902354 CACCCTGGCCTCCTCTTCCTTGG + Intergenic
1004637884 6:17486353-17486375 CGCCTTAGCCTCCCAGTGCTGGG - Intronic
1004647734 6:17579288-17579310 CACCTGGGCCTCCCAGTGCTGGG + Intergenic
1004939005 6:20536182-20536204 CACCTTGGCTTCCCAGTGTTGGG + Intronic
1005184383 6:23148591-23148613 CACCTTGGCCTCCAAATTGTTGG + Intergenic
1005652650 6:27898563-27898585 CACCTTGGCCTCTGAAAGCTGGG + Intergenic
1006530966 6:34653472-34653494 CACCTCGGCCTCCCAAAGCTGGG + Intronic
1006543594 6:34760796-34760818 CACCTTGGCCTCCTAGTGCTGGG - Intronic
1007670845 6:43552304-43552326 CACCTTAGCCTCCACGTGCTAGG + Intronic
1008017008 6:46531960-46531982 CGCTCTGGCCTCCTAGTGCTGGG + Intergenic
1009723969 6:67511706-67511728 CACCTTGGCTTCCCAATCCTGGG + Intergenic
1010686585 6:78860313-78860335 CACCTCGGCCTCAAAGTGCTGGG + Intergenic
1011585102 6:88916222-88916244 CGCCTTGGCCTCCAAGTGCTGGG - Intronic
1012071174 6:94618745-94618767 CACCTTGGTCTCCTAAAGCCTGG - Intergenic
1012214488 6:96565004-96565026 GACCTTGGCCTCCCAAAGCTAGG - Intronic
1013272300 6:108556581-108556603 CACCTCGGCCTCCCATAGCTGGG + Intergenic
1013565098 6:111350835-111350857 CACCTTGGCCTCCCAAAGATGGG + Intronic
1013756581 6:113469122-113469144 GACCTAGCCATCCTATTGCTGGG + Intergenic
1013805557 6:113992474-113992496 CACCTTGTCCTCCAATAACTTGG + Intronic
1014555144 6:122836639-122836661 CACAGTGGCCTGCTAGTGCTTGG - Intergenic
1014694436 6:124601554-124601576 CACAATGGCCTCCTCTTCCTGGG - Intronic
1014757076 6:125313178-125313200 CACCTCGGCCTCCCAGTGCTGGG - Intergenic
1015986309 6:138887472-138887494 CGCCTCGGCCTCCCAGTGCTGGG + Intronic
1016284044 6:142452766-142452788 CACCTTGGCATCCACTTCCTGGG - Intergenic
1016822577 6:148360597-148360619 CACCTTGGCCCCCCAGTGTTGGG + Intronic
1017278487 6:152597533-152597555 TGCCTTGGCCTCCTATAGTTTGG + Intronic
1017834088 6:158161125-158161147 CACCTTGGCCTCCAAGTGCTGGG - Intronic
1018100342 6:160432672-160432694 CGCCTTGGCCTCCCAATGTTAGG + Intronic
1018156101 6:160986640-160986662 CACCTTGGCCTCCCAGTGCTGGG + Intergenic
1019476070 7:1244937-1244959 CCCCTTGGCGTCCTAATGTTTGG + Intergenic
1019965319 7:4494096-4494118 CACCTCGGCCTCCCAGTGCTGGG + Intergenic
1020029203 7:4920964-4920986 CACCTTGGCCTCCAAAGGATTGG + Intronic
1020063638 7:5170879-5170901 CGCCTTGGCCTCCCAGTGTTGGG + Intergenic
1020179055 7:5907107-5907129 CACCTTGGCCTCCCAGTGCTGGG + Intronic
1020234850 7:6347803-6347825 CATCTTGGCCTCCCAGTGCTGGG - Intronic
1020303879 7:6817762-6817784 CACCTCGGCCTCCCAGTGCTGGG - Intronic
1020629878 7:10626595-10626617 CACCTTGGCCTCCCAGTGTTGGG - Intergenic
1021090619 7:16478498-16478520 CACCTTGGCCTCCTAAAGTTAGG + Intronic
1022094301 7:27129586-27129608 CTCCTTGGCCTTCTATTTCGGGG - Intronic
1023039832 7:36162393-36162415 CACCTTGGCCTCCCAAAGTTGGG - Intronic
1023251272 7:38264340-38264362 CACCTCGGCCTCCAAGTGCTGGG - Intergenic
1023388860 7:39687999-39688021 CACCTTGGGCTCCCAAAGCTGGG + Intronic
1023760813 7:43463735-43463757 CACCTCCGCCTCCTCCTGCTGGG - Exonic
1024551496 7:50566204-50566226 CACCTAGGGTTCCTATTGTTAGG + Intergenic
1024581100 7:50801855-50801877 CTCCTTGCCCTCCTACTGTTAGG + Intergenic
1025244159 7:57303615-57303637 CGCCTTGGCCTCAAAGTGCTGGG + Intergenic
1025825843 7:65009765-65009787 AGCCTTGGCCTCCCAGTGCTGGG - Intergenic
1025898839 7:65727550-65727572 AGCCTTGGCCTCCCAGTGCTGGG - Intergenic
1026150011 7:67779971-67779993 CACCTCAGCCTCCTGTAGCTGGG - Intergenic
1026884097 7:73927866-73927888 CACCTCGGCCTCCCAGTGCTGGG + Intergenic
1026913215 7:74104820-74104842 GAGCTTGGCCTCCTCTTGCAGGG + Intronic
1026914365 7:74111186-74111208 CACCTTGGCCTCCCAGTGTTGGG - Intronic
1027111961 7:75447077-75447099 CATCCTGGCATCCTATTACTAGG + Intronic
1027284191 7:76631608-76631630 CATCCTGGCATCCTATTACTAGG + Intergenic
1027334213 7:77131129-77131151 CACCTTGGCTTCCCAAGGCTGGG + Intronic
1027416330 7:77978531-77978553 CACCTCGGCCTCTCAGTGCTAGG + Intergenic
1028996139 7:97102251-97102273 CACCTCGGCCTCCCAAAGCTGGG + Intergenic
1029231665 7:99074777-99074799 CACCTTGGCTTCCCAGTGTTGGG - Intronic
1029289378 7:99490403-99490425 AGCCTTGGCCTCCCAGTGCTGGG + Intronic
1029296791 7:99546607-99546629 CACCTCGGTCTCCCACTGCTGGG + Exonic
1029404418 7:100366200-100366222 CACCTTGGCCTCCCAATCCTGGG + Intronic
1029498576 7:100912642-100912664 CACCTCAGCCTCCCAATGCTGGG - Intergenic
1029595642 7:101536262-101536284 CGCCTTGGCCTCCCAGTGTTGGG + Intronic
1029781637 7:102740469-102740491 CACCTTGGCTTCCCAAGGCTGGG - Intergenic
1029846553 7:103417988-103418010 CACCTTGGCCTTCCAGTGTTGGG + Intronic
1029980300 7:104872394-104872416 CACCTTGGCCTCCTAAAGTGTGG - Intronic
1030091140 7:105860029-105860051 CGCCTTGGCCTCCAAAGGCTGGG + Intronic
1031042075 7:116849288-116849310 CACTTTGGCCTCAAAGTGCTGGG - Intronic
1031047865 7:116913860-116913882 CACCTTGGCCTCCAAAAGTTTGG + Intronic
1031114187 7:117649955-117649977 CACATTGGATTCCTATTGCTTGG - Intronic
1031768558 7:125812123-125812145 CACCTTGGCCTCCCAGTGCTGGG + Intergenic
1031976945 7:128100159-128100181 CGCCTTGGTCTCCCAGTGCTGGG - Intergenic
1032204216 7:129847589-129847611 CGCCTTGGCCTCCCAGTGCTGGG + Intronic
1032390126 7:131550404-131550426 CACCTCAGCCTCCCAGTGCTAGG - Intronic
1033039215 7:137903059-137903081 CACCTTGGCCTCCCAAAGCACGG + Intronic
1033208945 7:139446089-139446111 CGCCTCGGCCTCCCAGTGCTGGG + Intergenic
1033405427 7:141068416-141068438 CTCCTTGGCCTCCCAAAGCTGGG + Intergenic
1033471085 7:141649831-141649853 CACCATGTCCTCCTATTCCCAGG + Intronic
1034146039 7:148872950-148872972 CACCTTGTCCTCCCAAAGCTGGG - Intronic
1034173696 7:149083463-149083485 CGCCTCGGCCTCCCAGTGCTAGG + Intronic
1034185175 7:149170485-149170507 CGCCTTGGCCTCAAAGTGCTGGG - Intronic
1034193222 7:149226557-149226579 CGCCTCGGCCTCCCAGTGCTGGG - Intergenic
1035223675 7:157421884-157421906 CGCCTCGGCCTCCCAGTGCTGGG + Intergenic
1035674807 8:1449203-1449225 CAGCTGAGCCTCCTATTGCCAGG + Intergenic
1035740585 8:1925385-1925407 CACCTTGAACTCCTGCTGCTTGG - Exonic
1037042689 8:14257078-14257100 CACTTTGGCCTTCTAGTGCTAGG - Intronic
1037367374 8:18137128-18137150 CGCCTTGGCCTCCCAGTGCTGGG + Intergenic
1037623192 8:20585067-20585089 TACCTCGGCCTCCCAGTGCTGGG + Intergenic
1037832083 8:22195720-22195742 CACCATAGCCTCCCATTCCTGGG + Intronic
1038044800 8:23757227-23757249 AGCCTTGGCCTCCTCTGGCTCGG + Intergenic
1038183012 8:25246525-25246547 CACCTTGGCCTCCCAGTGTTGGG + Intronic
1038805551 8:30787815-30787837 CAGCTTGGCCTCCCAAAGCTGGG + Intronic
1039709985 8:40046051-40046073 CGCCTTGGCCCCCAAGTGCTGGG - Intergenic
1040915536 8:52564227-52564249 CACCTTGCTCTGCTCTTGCTGGG + Intronic
1041658996 8:60382774-60382796 CACCTCGGCCTCACAGTGCTGGG - Intergenic
1041675776 8:60537926-60537948 CACCTCAGCCTCCCAGTGCTGGG + Intronic
1042238812 8:66641473-66641495 CACCTCAGCCTCCCAGTGCTGGG + Intronic
1042251906 8:66764582-66764604 CACCTCAGCCTCCTGTAGCTGGG + Intronic
1042299527 8:67261752-67261774 CACCTTGGCTTCCCAAAGCTGGG + Intronic
1043404817 8:79919580-79919602 CACCTTGGCCTCCTAAATTTTGG + Intronic
1043723368 8:83576879-83576901 CACCAGTGCTTCCTATTGCTTGG - Intergenic
1044287438 8:90425443-90425465 CAACCTGGCCTCCAATTCCTGGG + Intergenic
1044937893 8:97310639-97310661 CACCTCAGCCTCCAAGTGCTGGG + Intergenic
1044993791 8:97819981-97820003 CACCTCGGCCTCCCAAAGCTGGG + Intronic
1045016276 8:98004036-98004058 CGCCTTGGCCTCCCTGTGCTGGG - Intronic
1045047772 8:98295475-98295497 CACTTTAGCCTCATATTCCTGGG + Intergenic
1045303370 8:100934450-100934472 CACCTTGGCCTCCTAAAGTGTGG - Intronic
1045593687 8:103628600-103628622 CACCTTGGCGTCCCATGGCTTGG + Intronic
1046750357 8:117920350-117920372 CGCCTCGGCCTCCAAGTGCTGGG + Intronic
1046944255 8:119959777-119959799 CTCCTTGGCCTCAAAATGCTGGG + Intronic
1047164169 8:122418356-122418378 CACCTTGGCCTCCTAGTGTTGGG - Intergenic
1047904455 8:129458415-129458437 CACATTGGCGTCTTCTTGCTAGG - Intergenic
1048897979 8:139011482-139011504 TGCCTTGGCCTCCCAGTGCTAGG + Intergenic
1049079299 8:140429336-140429358 CACCGTGGCCTCCCAGTGCTGGG + Intronic
1049091452 8:140517653-140517675 CACCTCGGCCTCCCAGTGATGGG + Intergenic
1049141640 8:140960456-140960478 CACCTCGGCCTCCCAGTGTTGGG + Intronic
1049837610 8:144748320-144748342 CGCCTCGGCCTCCCAGTGCTGGG + Intronic
1050050942 9:1600929-1600951 CACTTTGGCCTCCCAGTGTTGGG - Intergenic
1050717051 9:8541615-8541637 CACCCTGGCCTTCCAGTGCTGGG + Intronic
1051283293 9:15466127-15466149 CACCTTGGCTTCCCAGTGTTGGG - Intronic
1051297874 9:15616332-15616354 CACCTTGGCCTCAAAGTGCTGGG + Intronic
1052300150 9:26944877-26944899 CACCTTGGCCTCCCAGTGTTGGG - Intronic
1053203025 9:36165564-36165586 CACCTTGGCCTCCTAATGTATGG - Intergenic
1055217385 9:73883020-73883042 CACCTTGGCCTCAAAGTGCTGGG - Intergenic
1055575777 9:77659200-77659222 CACCTTGGCCTCCCAAAGCGAGG - Intergenic
1056103651 9:83325438-83325460 CACCTCAGCCTCCTATAGCTAGG + Intronic
1057197842 9:93124896-93124918 CACCTGGGTGTCCTACTGCTGGG + Exonic
1057320617 9:94009394-94009416 CGCCTTGGCTTCCTATTACAGGG + Intergenic
1057472536 9:95370424-95370446 CACTGGGGCCTCCTCTTGCTGGG + Intergenic
1057475017 9:95391834-95391856 CTCCTCGGCCTCCAAGTGCTGGG + Intergenic
1057616625 9:96596743-96596765 CACCTCAGCCTCCTGTAGCTGGG - Intronic
1058101029 9:100917749-100917771 GACTTTGGCCTCACATTGCTTGG + Intergenic
1058849410 9:108996210-108996232 CGCCTTGGCCTCCAAGTGTTGGG + Intronic
1058963532 9:110015348-110015370 CACCTTGGCCTCCCAGTGTTGGG - Intronic
1058964144 9:110020857-110020879 CACCTCAGCCTCCCAGTGCTTGG - Intronic
1060400917 9:123349207-123349229 TACCTTGGCCTCCCAGTGTTGGG - Intergenic
1060746512 9:126137292-126137314 CACCTCAGCCTCCTATAACTGGG + Intergenic
1060771227 9:126333650-126333672 CACCTTGGCCTCAGAGTGCTGGG + Intronic
1060981055 9:127792214-127792236 CACCTTGGCCTCCCAGTGTTGGG - Intergenic
1061066584 9:128281822-128281844 CACCTTGGCCTCCCAGTGTTAGG - Intronic
1061933100 9:133843453-133843475 CACCTTGGCCTCCCAGTGTTGGG + Intronic
1061956539 9:133965237-133965259 CACCTTGGCCTCCCAATGTGCGG - Intronic
1062051345 9:134448654-134448676 CACCTTGGCCCTCTATTCCCTGG - Intergenic
1186704101 X:12123854-12123876 CACCTTGGTCTCCCACTCCTGGG + Intergenic
1187156140 X:16721783-16721805 CACCTTGGCCTCAAAGTGGTGGG + Intronic
1187179708 X:16932411-16932433 CACCTTGAACTCATACTGCTTGG + Intergenic
1187530153 X:20089029-20089051 CGCCTTGGTCTCCCAGTGCTAGG + Intronic
1189392943 X:40592402-40592424 CATCTTGGCCTCCCAAAGCTGGG - Intronic
1189824747 X:44906767-44906789 CACCTCGGCCTCCCAGTGTTGGG + Intronic
1190080296 X:47351589-47351611 CACCTTGGCCTCCCAATGCTGGG + Intergenic
1190824165 X:54001664-54001686 CACCTCAGACTCCTTTTGCTGGG - Intronic
1191244322 X:58213965-58213987 CACCTCAGCCTCCCAGTGCTGGG + Intergenic
1191986677 X:66988403-66988425 CATCTTGGCCTCAAGTTGCTGGG + Intergenic
1192122770 X:68472826-68472848 CACCTCGGCCTCCCAGTGCTGGG - Intergenic
1192774062 X:74223533-74223555 CACCTCAGCCTCCAAGTGCTGGG + Intergenic
1195283386 X:103358805-103358827 CGCCTTGGCCTCCCAATGTTGGG - Intergenic
1195931794 X:110085413-110085435 CACCTTGGCTTCCCAGTGTTAGG + Intronic
1196089390 X:111723518-111723540 CACCTTGGCCTCCCAATGTTGGG + Intronic
1196695397 X:118606315-118606337 CGCCTCGGCCTCCCAGTGCTGGG + Intronic
1196869925 X:120102993-120103015 CACCTTGGCCTCCCAGTGCTGGG + Intergenic
1197840382 X:130740150-130740172 CACCTCGGCCTCCCAAAGCTGGG - Intronic
1198081571 X:133245106-133245128 CACCTTGGCCTCCCAGTGTTGGG - Intergenic
1198210433 X:134510975-134510997 CACCTCGGCTTCCCAGTGCTGGG - Intronic
1198720795 X:139617419-139617441 CACCTTGCCCTCCTGTCGCATGG - Intronic
1199769516 X:150965536-150965558 CACCTTAGCCTCCTAATGCTGGG + Intergenic
1200886390 Y:8275650-8275672 CACCTTCACCTCCCAGTGCTGGG + Intergenic
1201023182 Y:9679212-9679234 CACTTTGACCTCCTTCTGCTGGG + Intergenic
1201446640 Y:14064116-14064138 CACCTTGCCCTCCTCCTGCATGG + Intergenic
1201491257 Y:14544248-14544270 CCCCATGGCCTCCAAATGCTTGG + Intronic
1201506473 Y:14706525-14706547 TGCCTTGGCCTCCTATGTCTTGG + Intronic