ID: 951966332

View in Genome Browser
Species Human (GRCh38)
Location 3:28389762-28389784
Sequence TGGCAAGTCCAGTTTCTGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 162}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951966332 Original CRISPR TGGCAAGTCCAGTTTCTGAT GGG Intronic
900849302 1:5129870-5129892 TGGCAAGTGCAGTGTCAGAGGGG + Intergenic
904460089 1:30671443-30671465 TGGCAAGTCCAAACTCTAATGGG - Intergenic
904920577 1:34004867-34004889 TGGCAAGTCCAGAGCCAGATGGG - Intronic
905938097 1:41840720-41840742 TGGCACGGCCAGGATCTGATGGG - Intronic
905943361 1:41882001-41882023 AGGAAAGTCCATTTTCTCATAGG + Intronic
910214573 1:84830206-84830228 TGGCAAGTCCAGTTACAAACAGG - Intronic
910538614 1:88329149-88329171 TGGCAAGTCCAAAATCTGATGGG + Intergenic
911744162 1:101420772-101420794 TGGCAAGTCCAAAATCTGATAGG - Intergenic
917191143 1:172420639-172420661 TGAAAAGCTCAGTTTCTGATTGG - Intronic
919592287 1:199519890-199519912 TCCCAAGTCCAGTTTGTCATAGG - Intergenic
923395925 1:233562914-233562936 GGCAAAGTCCAGTTTCTCATAGG - Intergenic
1065373389 10:25012587-25012609 TTGCAAGTCCAGATTCTAATAGG - Intronic
1067966102 10:50914552-50914574 TGGCTAGGACAGATTCTGATTGG + Intergenic
1069065871 10:63941424-63941446 TGGCAAGGACAGTTCCTGGTGGG + Intergenic
1077844480 11:6010566-6010588 TGGCAATTTCAATGTCTGATGGG - Intergenic
1080197422 11:29628838-29628860 ACGCAAGAGCAGTTTCTGATGGG + Intergenic
1083325656 11:61871821-61871843 GGGCAAGTCCTGTTTCTGCCAGG - Intergenic
1083342857 11:61969532-61969554 TGGAAAGTACAGTTTATGTTGGG + Intergenic
1084647821 11:70470218-70470240 TGGTCAGTGCAGGTTCTGATAGG + Intronic
1088717875 11:112564821-112564843 GGGAAAGTCCAGGGTCTGATTGG + Intergenic
1089687648 11:120167058-120167080 AGGCAAGTGCAGTTTGTGAATGG - Intronic
1091729403 12:2868949-2868971 TGACAAAACCAGTTTCTTATTGG - Intronic
1099996522 12:89785253-89785275 TGGCCACTCCAGATTCTGGTTGG - Intergenic
1100198437 12:92273279-92273301 TGGCAAGTCCACAATCTGATGGG - Intergenic
1101360165 12:104018927-104018949 AGGCAAATCCAGGTTCTGATGGG + Intronic
1102611886 12:114119581-114119603 TGCCAAGTGCAGTTCCTCATTGG + Intergenic
1103447205 12:121002018-121002040 TGCCAAGTCCAGGTCCTGGTGGG + Exonic
1106456762 13:29934634-29934656 TGGGAAGTGGAGTATCTGATTGG + Intergenic
1111186850 13:84748717-84748739 TGGTAAGTCCAAAATCTGATCGG - Intergenic
1111620165 13:90715084-90715106 TGGCAATTCCAGATTCTGCAGGG + Intergenic
1112600522 13:100850969-100850991 TGGCAGATTCAGTGTCTGATGGG - Intergenic
1113071365 13:106424635-106424657 TGAGGATTCCAGTTTCTGATAGG - Intergenic
1118017008 14:61670872-61670894 TGGAAAGGACAGTTGCTGATAGG + Intergenic
1120405914 14:84092670-84092692 TGGCAGGTCCAGTTTTTGGTGGG - Intergenic
1121896744 14:97655757-97655779 TGGCACTTTCAGTGTCTGATGGG - Intergenic
1121960869 14:98258261-98258283 TGGCAAGTTCAGAGTCTGGTGGG + Intergenic
1122725483 14:103748006-103748028 TGGCAAGTCCAGAATCTGTGAGG - Intronic
1122780968 14:104143378-104143400 TGGCGAGTCCTGTTTCTCCTTGG + Intronic
1123161032 14:106277987-106278009 TGGCGAGTCCAGGAACTGATGGG + Intergenic
1123165999 14:106325213-106325235 TGGCGAGTCCAGGAACTGATGGG + Intergenic
1123208738 14:106738539-106738561 TGGCGAGTCCAGGAACTGATGGG + Intergenic
1123480237 15:20624384-20624406 TGGCAAGTGCAGGAACTGATGGG + Intergenic
1123637769 15:22375979-22376001 TGGCAAGTGCAGGAACTGATGGG - Intergenic
1124089311 15:26582956-26582978 TGTCAAGCCGAGTTCCTGATGGG + Intronic
1124479307 15:30063993-30064015 TGGCAAGTCCAGAATCTGTAGGG - Intergenic
1125755855 15:42064400-42064422 TGGTGAGTCCAGAGTCTGATGGG + Intergenic
1129672979 15:77617293-77617315 TTGCCAGGCCAGTTTCTCATGGG - Intronic
1130828049 15:87569809-87569831 TAGCAGTTCCAGTTTCTGGTGGG + Intergenic
1130845739 15:87743424-87743446 TGGCAAATTCAGTTTCTGGTAGG - Intergenic
1131352530 15:91714415-91714437 TGACAAGTGCAGTTACTGTTGGG + Intergenic
1134247660 16:12552021-12552043 TGGCAAGTCCAGGCTCAGATGGG + Intronic
1138389215 16:56658030-56658052 TGGAAAGTCCAGTCTCTCCTCGG + Exonic
1139250957 16:65495563-65495585 TATCAAGTCCAGTCTCTAATAGG + Intergenic
1140235793 16:73157374-73157396 TGGCAAGCCCGATGTCTGATTGG - Intergenic
1146216949 17:30984715-30984737 TGTCTGGTCCAGATTCTGATAGG - Exonic
1146404529 17:32525851-32525873 TGGGAGGTCCAGTTTCTCCTCGG - Intronic
1150841425 17:68610620-68610642 TGGCAGATCCAGTGTCTGATGGG + Intergenic
1155753514 18:29459697-29459719 TGGCAAGTCCAGTTTCTTAAAGG + Intergenic
1156241097 18:35254892-35254914 AGGCAATTTCAGATTCTGATAGG + Intronic
1159779144 18:72641421-72641443 TGTAAAGTACAGTTTCTGTTTGG + Intergenic
1160504380 18:79418814-79418836 TTGCAACACCAGTTTCTGATGGG + Intronic
1162272424 19:9627261-9627283 TTGCAAGTCCTGTATCTGACTGG - Intronic
1163730048 19:18943689-18943711 TGGCTAGTCCAGCTTCAGGTTGG - Intergenic
1164877125 19:31699422-31699444 AGGCAAGCCCACTTTCTTATAGG - Intergenic
1165577841 19:36836912-36836934 TTGCAAGATCAGTGTCTGATAGG - Intronic
1168469538 19:56629309-56629331 TGGGAAGTGCAGTCTCTGGTAGG + Intergenic
925166790 2:1720504-1720526 TGGCAAGTCCAGAGTCTGCAGGG + Intronic
929877478 2:45808747-45808769 TGGTTAGTCCAGTCTCAGATGGG + Intronic
930814683 2:55582459-55582481 TGGCATCTCTATTTTCTGATTGG + Intronic
930826515 2:55701274-55701296 TGGCCAGTCCAATTCCTGATAGG + Intergenic
931067650 2:58604869-58604891 TGTCGAGTCCAGTTTTTGAGTGG - Intergenic
931621259 2:64211873-64211895 AGGCAAGTTCAGTTTCAGCTAGG - Intergenic
933264715 2:80169383-80169405 TGGGAAGGCCAGATTCTGATTGG - Intronic
933310579 2:80656802-80656824 TTGCAAATCAAGTATCTGATAGG + Intergenic
935120025 2:100176246-100176268 TGCCAAGTGCAGTTACTGAAAGG - Intergenic
938561072 2:132472361-132472383 TGGCAAGTGGATTTGCTGATAGG - Intronic
939278070 2:140027504-140027526 TGGGCAGTCCAGTTTCTAACAGG - Intergenic
939515378 2:143160817-143160839 TGGCAAGTCCAATTTGTGCTTGG - Intronic
940233678 2:151486099-151486121 TTGCAAGTCATGTATCTGATAGG + Intronic
940625852 2:156173866-156173888 AGGCAAATCAATTTTCTGATAGG + Intergenic
940895091 2:159073845-159073867 TGGCAAGTGTAGTTCCTGAGTGG + Intronic
941994630 2:171590741-171590763 TGGCAAGGCCAGTTCCTCCTTGG - Intergenic
944498297 2:200330925-200330947 TGGCAAGACCAGTTACAGAAGGG - Intronic
947380626 2:229541777-229541799 TGGCAAGTGCAATATCTAATGGG - Intronic
947587587 2:231366102-231366124 TGGCAAGCGCAGAATCTGATGGG + Intronic
1169041274 20:2497586-2497608 TGGCAAGAACAGTTTCTGGAGGG + Intronic
1169338145 20:4774292-4774314 TTGCATGTCCAGTTTCTGAAAGG + Intergenic
1170716283 20:18833849-18833871 TGACAAGTCCAAATTCTGAAGGG + Intergenic
1172449205 20:35009959-35009981 TGTCAAGTGCAGGTACTGATGGG + Intronic
1173545318 20:43893404-43893426 TCCCAAGTCCAGTTTCTCAATGG - Intergenic
1173896533 20:46555252-46555274 TAGCAAGTCCAAAATCTGATGGG - Intergenic
1177314793 21:19444660-19444682 TAAGAAATCCAGTTTCTGATGGG - Intergenic
1182697951 22:32208917-32208939 TGGCTAATGCAGTTTCTGCTGGG + Intergenic
1183376762 22:37469816-37469838 TGGCAAGCCCAGGATCTGAGTGG - Exonic
949560278 3:5195119-5195141 TGGCAATTATAGTTTCTGATGGG + Intronic
951966332 3:28389762-28389784 TGGCAAGTCCAGTTTCTGATGGG + Intronic
952963111 3:38605004-38605026 GTGCAAGTCCACTTACTGATAGG - Intronic
953644270 3:44739549-44739571 TGGCAAGTCCAAATTCTGCAGGG - Intronic
955511433 3:59684532-59684554 TCCCAAGTCCAGTTTCTCAAGGG - Intergenic
958657548 3:97021587-97021609 TGGCAAGGTTAGTTTCTGGTGGG + Intronic
958931687 3:100214453-100214475 TGGCAAGTCCAAAATCTGACAGG + Intergenic
959633163 3:108531847-108531869 TGGCAAGACCTGTTGCTAATAGG - Intergenic
962069699 3:132020491-132020513 TGGGAACTCCAGTTCCTGAAGGG + Intronic
963131779 3:141865054-141865076 TGGCAACTCCATTTTCTGCAGGG + Intergenic
966288865 3:178331007-178331029 TAGTACATCCAGTTTCTGATGGG - Intergenic
967063323 3:185891769-185891791 TGGCAAGTACTGTTTCTTCTTGG + Intergenic
968198198 3:196728189-196728211 TGGCAAGTCCTCCTTCTGCTAGG + Intronic
968740150 4:2324140-2324162 TGGAAAGTCCAAATTCTGCTGGG + Intronic
969133600 4:5011827-5011849 AAGCAAGTCCCGCTTCTGATGGG + Intergenic
969702934 4:8777627-8777649 GGGCAAGTCCATTTTCAGAGGGG + Intergenic
971000667 4:22318503-22318525 TGGCAAAGACATTTTCTGATGGG + Intergenic
976020982 4:80625716-80625738 TGGCCACTCCAGTTTGTGTTTGG - Intronic
979384493 4:120048526-120048548 TGGCATTTTCAGTTTCTGGTAGG + Intergenic
981067618 4:140501682-140501704 TGGAAACTCTAGTTTCTGGTTGG + Intergenic
981172301 4:141638495-141638517 TGGCAACTCCAGAACCTGATTGG + Intronic
984269445 4:177533374-177533396 TGGCAAGTCAGTCTTCTGATAGG + Intergenic
984620697 4:181949156-181949178 TGACAAGTTCAATTTCTGCTTGG - Intergenic
985378881 4:189371562-189371584 TGGCAGGGCCAGTTTCTTCTGGG + Intergenic
987803391 5:22728679-22728701 CGGCAAATCCAGTGTCTGTTAGG + Intronic
991402787 5:66272049-66272071 TGGCAGTTTCAGTGTCTGATAGG + Intergenic
992945167 5:81802680-81802702 TGACAAGTTCAGTATCTGTTGGG + Intergenic
993404777 5:87498018-87498040 TGGCTTTTACAGTTTCTGATTGG + Intergenic
997393814 5:133540165-133540187 TGGCAAATCCAGAATCTGATGGG - Intronic
997815211 5:137010401-137010423 TCGCAAGTCCATTTTCTGTTTGG - Intronic
1000873260 5:166603776-166603798 TTGCAAGTCATGTATCTGATAGG - Intergenic
1004632338 6:17433944-17433966 TTCCAAGTCCAGTTTCTTACTGG - Intronic
1006628694 6:35415853-35415875 TGGCAAGTCCAAATTTTGAAAGG + Intronic
1007735306 6:43978617-43978639 TGGCAAGCCCAGCTTCTGGCTGG - Intergenic
1008119722 6:47598069-47598091 TACTTAGTCCAGTTTCTGATGGG - Intronic
1011486462 6:87846864-87846886 GGGCAAGTCAAGTTTCTTATTGG + Intergenic
1011568427 6:88706056-88706078 TGGCAAATTCAGTTTTTGCTTGG - Intronic
1012278982 6:97306022-97306044 GGGAAAGTCCAGTTTATGCTCGG - Intergenic
1014361667 6:120484434-120484456 TGGCAAGTCCAAAATCTGCTGGG - Intergenic
1015087694 6:129315120-129315142 TGACAAGTCCTGGTTCTCATTGG - Intronic
1015825008 6:137301988-137302010 TAGCAAGTCCTGTTTCAGGTAGG - Intergenic
1016023597 6:139261140-139261162 TTCCATGTCCTGTTTCTGATTGG - Intronic
1016066201 6:139686011-139686033 TGGCAATTCCACTTTCATATAGG - Intergenic
1016229470 6:141785240-141785262 TGTGCAGTCCAGTTTCTAATAGG + Intergenic
1017139567 6:151178499-151178521 GGACAAGTGCAGTTTCTGACAGG + Intergenic
1018732865 6:166665910-166665932 TGTGAAATCCAGTTTCTGAGAGG + Intronic
1020458531 7:8401879-8401901 TGGCCAGTTCAGTCTTTGATGGG - Intergenic
1022914722 7:34936072-34936094 TGGCAAGTCAAGGTCCAGATGGG + Intronic
1023625750 7:42113554-42113576 TGGCAACTCCATTTTCTGTAGGG - Intronic
1023948620 7:44823467-44823489 TGGCATGTCAAGTTGCTGAGGGG - Intronic
1024192159 7:47023418-47023440 TAGAAAGTCCAGCTTCTGAATGG + Intergenic
1026141216 7:67708478-67708500 TGGCTAGTGCAGTTTCTCCTGGG - Intergenic
1030453407 7:109742725-109742747 TGGTAAGTCCAAAATCTGATGGG + Intergenic
1031536717 7:122942872-122942894 TTGCAAGTCCAGTTTCAGATAGG + Intergenic
1034557133 7:151857378-151857400 TGGTACTTCCAGTTGCTGATGGG - Intronic
1034725489 7:153331753-153331775 TGGCAAGTCCAAATTCTGCAGGG - Intergenic
1034739489 7:153460604-153460626 TGGCAAGTCATGTTAATGATTGG + Intergenic
1037782093 8:21876763-21876785 TGGGAAGCACAGTCTCTGATAGG + Intergenic
1038698816 8:29830378-29830400 TGGCAAGTCCAAATTCTGCTGGG - Intergenic
1038823818 8:30978706-30978728 TGACAGATCCAGTTTGTGATGGG + Intergenic
1040726028 8:50382845-50382867 TGGCAAGTCCAAATTCTGTAGGG + Intronic
1041447642 8:57970272-57970294 TGGCAGTTTCAGTCTCTGATGGG - Intergenic
1041814221 8:61949920-61949942 TGGAATCTCCATTTTCTGATTGG - Intergenic
1042510093 8:69602370-69602392 TGACAAGGCCATTTTATGATGGG - Intronic
1044226975 8:89730294-89730316 AGGGAAGTCCAGGTTCTGATAGG - Intergenic
1044558341 8:93588739-93588761 GAGAAAGTCCATTTTCTGATGGG - Intergenic
1044934880 8:97284340-97284362 TGGCATATCCAGGTTCTGTTGGG - Intergenic
1047053285 8:121137421-121137443 TGGCAAATTCAGTGTCTGATGGG - Intergenic
1048407973 8:134142376-134142398 TGGCAAAGCCATTTTCTGCTTGG - Intergenic
1048743940 8:137592285-137592307 GGTCAAGTCCTGTTTCTGACTGG + Intergenic
1048827084 8:138438780-138438802 TGGCTGGTCCAGTATCTGGTTGG - Intronic
1048889913 8:138937593-138937615 TGGCAAGTCCAGAATCTGTAGGG - Intergenic
1049032496 8:140048033-140048055 TGGCCAGCCCAGCTTCTGCTGGG - Intronic
1052265412 9:26566189-26566211 TGGCCAGTGCTGTTTCTGATGGG - Intergenic
1053205780 9:36185031-36185053 TGGCAAGTCCAGAATCTGCAGGG - Intergenic
1053415648 9:37945392-37945414 TGGCCAGTCCAGCTGCTGGTTGG - Intronic
1053489853 9:38490209-38490231 TGGGTGGTACAGTTTCTGATTGG - Intergenic
1055987923 9:82071382-82071404 TGGCAAGTCCAAAATCTGAAGGG - Intergenic
1056031383 9:82557189-82557211 TGTCAATTACAGTTTCTGAATGG - Intergenic
1056537978 9:87547663-87547685 TGGCAAGTCCAGAATTTGCTGGG + Intronic
1057827523 9:98382283-98382305 TGGCAACTCCAGTTTCTCAGTGG - Intronic
1058136123 9:101309484-101309506 TCCTAAGTCCAGTTTTTGATAGG + Intronic
1058402707 9:104636440-104636462 TGGCAAGTCCAGTGGCAGCTTGG - Intergenic
1059462014 9:114437696-114437718 TGGCCAGTTCAGTTCCTGATAGG - Intronic
1061468806 9:130805963-130805985 TGGCAACTGCAGTTTCAGAATGG + Intronic
1061638037 9:131927840-131927862 TGGCAGGTCCAGTCTGTAATTGG - Intronic
1062151155 9:135019755-135019777 TGGCAGCTGCAGTTTCTGCTGGG - Intergenic
1186801608 X:13098255-13098277 TGGCAAATCCAGTGTCTGGTGGG - Intergenic
1188065586 X:25655761-25655783 TGGCCAGCCCAGATTCTGAGGGG + Intergenic
1188423807 X:30023242-30023264 TGGCAAGTCCAGAATCTGCAGGG - Intergenic
1188777161 X:34234078-34234100 TAGCTCCTCCAGTTTCTGATTGG - Intergenic
1189177126 X:38968916-38968938 TGGCCAGTCCAGCTTCTATTTGG - Intergenic
1190067041 X:47248600-47248622 TGTCATCTCCAGTTTCGGATGGG + Intergenic
1194560862 X:95418140-95418162 TGGCAAGTCCAAAATCTGACAGG + Intergenic
1200548778 Y:4552891-4552913 TGGCTTGTACAGTTTCTGACAGG + Intergenic
1201428392 Y:13879820-13879842 TGGGATGTACTGTTTCTGATGGG + Intergenic