ID: 951977026

View in Genome Browser
Species Human (GRCh38)
Location 3:28522468-28522490
Sequence ATGGATTTATAAATGGACAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 608
Summary {0: 1, 1: 0, 2: 2, 3: 46, 4: 559}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951977022_951977026 16 Left 951977022 3:28522429-28522451 CCTATCTCGAAGTCTGTCTGTTC 0: 1
1: 0
2: 0
3: 6
4: 138
Right 951977026 3:28522468-28522490 ATGGATTTATAAATGGACAAAGG 0: 1
1: 0
2: 2
3: 46
4: 559
951977024_951977026 -6 Left 951977024 3:28522451-28522473 CCTAGATGTAGAAAAAGATGGAT 0: 1
1: 0
2: 1
3: 36
4: 317
Right 951977026 3:28522468-28522490 ATGGATTTATAAATGGACAAAGG 0: 1
1: 0
2: 2
3: 46
4: 559

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951977026 Original CRISPR ATGGATTTATAAATGGACAA AGG Intronic
900816322 1:4849240-4849262 ATAGATAGATAAATGGACAGTGG - Intergenic
900930857 1:5736461-5736483 ATGGATAGATAGATAGACAAAGG + Intergenic
902603883 1:17558106-17558128 ATGGATGGATGGATGGACAATGG - Intronic
902721175 1:18305196-18305218 ATGGATGGATGAATGGATAATGG + Intronic
902794479 1:18792285-18792307 CTGAATATACAAATGGACAATGG + Intergenic
903234459 1:21940659-21940681 ATGAATGAATGAATGGACAAAGG - Intergenic
903341661 1:22658744-22658766 ATGGATGGATAGATGGACAGAGG + Intronic
904292187 1:29494487-29494509 ACAGATTTTTAAATGGACAAAGG - Intergenic
904323940 1:29715164-29715186 CCAGATTTTTAAATGGACAAAGG - Intergenic
904346518 1:29875543-29875565 CTGAATATACAAATGGACAATGG + Intergenic
906076327 1:43054832-43054854 GTGGATGAATAAATGGAGAAGGG - Intergenic
906752012 1:48272940-48272962 AGCAATTTAAAAATGGACAAAGG - Intergenic
908168946 1:61485818-61485840 ATGGATTAAAAAATAGACAATGG + Intergenic
908999341 1:70199802-70199824 ATGGATTTTTGACTGCACAAGGG + Intronic
909150948 1:72004137-72004159 ATAAATATATAATTGGACAAAGG - Intronic
909589844 1:77335234-77335256 AAGGCTTTAAAAATGGACAGAGG + Intronic
909890675 1:81002313-81002335 ATGCATTTCTAAATAGCCAAAGG - Intergenic
910532420 1:88253066-88253088 ATTTATTTTTAAAAGGACAATGG + Intergenic
911509662 1:98795756-98795778 ATGGAAATAAAAATGGACAAAGG - Intergenic
911521637 1:98936821-98936843 ATAGATTTATTAGAGGACAAGGG + Intronic
911801372 1:102142607-102142629 ATGGATTTATAAAGCAACACAGG + Intergenic
912631819 1:111252936-111252958 AGGGATTTAAAAATTGACATGGG + Intergenic
913418384 1:118636954-118636976 AGGGATTTATATATGGTCTATGG - Intergenic
913428533 1:118762177-118762199 AATGATTTAAAAATGGGCAAAGG + Intergenic
914425146 1:147569135-147569157 ATGGGTGAACAAATGGACAAAGG + Intronic
914779496 1:150772132-150772154 ATGGATTTAGAAATAAACAAAGG - Intergenic
916477244 1:165181982-165182004 CAGGATATATAAATAGACAAAGG + Intergenic
916503718 1:165408858-165408880 ATGGAGGTAGAAAGGGACAACGG + Intronic
916657465 1:166888959-166888981 CTGGATTGAGAAACGGACAATGG - Intergenic
916805768 1:168259919-168259941 CCTGATTTTTAAATGGACAAAGG - Intergenic
917636305 1:176940156-176940178 CTGAATATACAAATGGACAATGG + Intronic
918439491 1:184552218-184552240 ACAGATTTTTAAATGGGCAAAGG + Intronic
918657235 1:187043308-187043330 CTGAATATATAAATGGACAATGG + Intergenic
918768854 1:188525942-188525964 ATGCATTTTTAAATGAAAAATGG + Intergenic
919025991 1:192171168-192171190 AGGGAAATATAAATGAACAATGG - Intronic
919102214 1:193108744-193108766 CTGAATATATAAATGGATAATGG - Intergenic
919225210 1:194689706-194689728 ATAGAATTACAAATGGAAAAAGG - Intergenic
919495416 1:198260079-198260101 ATGGATTTTTATATGTAGAAAGG + Intronic
920767007 1:208843043-208843065 CTGGATTTATAATTGAGCAAAGG - Intergenic
920813220 1:209306439-209306461 ATGGATTGCCAAGTGGACAAAGG + Intergenic
921762765 1:218936303-218936325 AAGAATTTAAAAATGAACAAAGG - Intergenic
921824537 1:219657670-219657692 ATGTATTTGTCCATGGACAATGG - Intergenic
922191378 1:223321568-223321590 ATGGCATTAGAAAGGGACAAAGG - Intronic
922720518 1:227898053-227898075 ATGAATTGATAAATGAACTAAGG + Intergenic
923304704 1:232677531-232677553 CTGGATTTAAAAATGGGCAAAGG - Intergenic
923376173 1:233365444-233365466 TTTGATTTAAAATTGGACAAAGG + Intronic
923608164 1:235464336-235464358 ATAATTTTATAAATGGGCAAAGG + Intronic
924027838 1:239855831-239855853 ATGGATTTTTAGATGGACAGAGG - Intronic
924206960 1:241722521-241722543 GTGGACTAATCAATGGACAAGGG + Intronic
1063092840 10:2883016-2883038 ATGAATTTAAATATGGACATGGG - Intergenic
1064367669 10:14722644-14722666 ATCAATTTAAAAATGGGCAAAGG - Intronic
1065867908 10:29929526-29929548 ATGTAATTATAAATTGTCAAAGG - Intergenic
1067185246 10:44021642-44021664 ATGAATTTAGAAAGGGACAGAGG - Intergenic
1067390466 10:45858541-45858563 AAAGATTTATAACTGGGCAATGG - Intergenic
1067813357 10:49449296-49449318 ATAACTTTAAAAATGGACAAAGG - Intergenic
1067872810 10:49977531-49977553 AAAGATTTATAACTGGGCAATGG + Intergenic
1068233497 10:54202054-54202076 ATGCATTTTTGAATGGACAGTGG + Intronic
1068267907 10:54678174-54678196 ATATATTTATATATGCACAAAGG + Intronic
1068752051 10:60605687-60605709 ATGGAAAAATCAATGGACAAAGG + Intronic
1068776056 10:60869590-60869612 ATGGATGTATAAATGAACTTGGG - Exonic
1069314914 10:67086120-67086142 ATGGATAGATAAATGGATGAAGG + Intronic
1069440168 10:68421286-68421308 CTGGGTTTACAAATGGACAGAGG - Intronic
1070760245 10:79019729-79019751 ATGGATGGATGAATGGACAATGG + Intergenic
1071003627 10:80858688-80858710 TTGGATGAATAAATGAACAAGGG + Intergenic
1071314391 10:84379672-84379694 ATGGATATATAAATGCATTAAGG - Intronic
1071352077 10:84756690-84756712 TTGAATATATAAATAGACAAGGG + Intergenic
1071378903 10:85037955-85037977 ATGGAATGAAAAATTGACAATGG + Intergenic
1071747754 10:88441194-88441216 AGGGATTTATAAATTGCCATGGG - Intronic
1073652545 10:105376990-105377012 AATGAATTATAAATGTACAAAGG - Intergenic
1073680339 10:105696594-105696616 TTGGATTTGGGAATGGACAAAGG + Intergenic
1074578958 10:114697685-114697707 ATGGATTTATTGATGGGCATAGG - Intergenic
1074620569 10:115115810-115115832 ATGGATATATAATTTGACTATGG - Intronic
1074832305 10:117257503-117257525 ATGGTTTTATCAATGAAGAAAGG - Intronic
1075215837 10:120533338-120533360 CCGGATTTAAAAATGGGCAAAGG - Intronic
1075217045 10:120545180-120545202 ATGGATTTGGAATTGGGCAATGG - Intronic
1075902090 10:126051386-126051408 ATGGGTATATAAATGGATGATGG - Intronic
1076366441 10:129923949-129923971 AATGATTCAAAAATGGACAAAGG + Intronic
1077304201 11:1861544-1861566 ATGGATGGATAGATGGATAATGG + Intronic
1077479903 11:2808874-2808896 ATGGATGAACACATGGACAATGG + Intronic
1077949280 11:6938158-6938180 ACAGTTTTTTAAATGGACAAAGG + Intronic
1078168014 11:8907284-8907306 ATGGAATTGTAAATGGAGAGAGG - Intronic
1078988322 11:16616093-16616115 GTGGGTCTATAAATGGAGAAAGG - Intronic
1079339653 11:19601521-19601543 ATGGATAAATAAATGAATAAAGG - Intronic
1080480416 11:32643074-32643096 ATGGATTTATATATGTAATATGG - Intronic
1080545161 11:33309717-33309739 ATGGATTGATAAATGGATAGAGG - Intronic
1080980485 11:37398267-37398289 AAGGATCTACAAATGGTCAAGGG + Intergenic
1081022360 11:37961912-37961934 ATTGTTATATAAATGGAAAACGG + Intergenic
1081097706 11:38959530-38959552 ATACATGTATAAATGGGCAAAGG + Intergenic
1081564938 11:44253835-44253857 ATGGATTAATAAAGACACAAAGG + Intergenic
1081652618 11:44834526-44834548 ATGCATTTAGCAAAGGACAATGG - Intronic
1083634615 11:64113719-64113741 ATGGATTGATACATGGATGATGG + Intronic
1083634721 11:64114296-64114318 ATGGATTGATACATGGATGACGG + Intronic
1084206864 11:67600055-67600077 AAAGATTTATAAATGTACAGGGG - Intergenic
1085462534 11:76702711-76702733 AGGGATGGATAGATGGACAATGG + Intergenic
1085557070 11:77433807-77433829 ACCAATTTAAAAATGGACAAAGG + Intronic
1085972504 11:81610558-81610580 ATGGACTAATAAGTGGCCAAAGG - Intergenic
1086284987 11:85237480-85237502 ATGGATTTTTGACTGCACAAAGG - Intronic
1086914592 11:92514633-92514655 ATGCACTTATGAATGGACAGAGG + Intronic
1087096743 11:94326330-94326352 CTGAATATATAAGTGGACAATGG - Intergenic
1089168556 11:116496865-116496887 CTGGATTTAAAAATTGGCAAAGG - Intergenic
1089957472 11:122585016-122585038 ATGGGTTCAGAAGTGGACAAGGG - Intergenic
1091081707 11:132675793-132675815 AAGTATTAATAAATGGAAAATGG + Intronic
1091318013 11:134629315-134629337 CTGGATTAAAAAATGGACAAAGG + Intergenic
1091358497 11:134956529-134956551 TTGGATTTTTAAGTGGAAAAAGG + Intergenic
1091949015 12:4576160-4576182 AAGGATGAATAGATGGACAATGG - Intronic
1091998753 12:5016378-5016400 ATGGTTTTATGAATACACAAGGG + Intergenic
1092297794 12:7215075-7215097 ACTATTTTATAAATGGACAAAGG + Intronic
1093512823 12:19949174-19949196 CTGAATATACAAATGGACAATGG + Intergenic
1094641567 12:32280896-32280918 ATGCTTTTTTAAAAGGACAAAGG + Intronic
1095724389 12:45435891-45435913 CTGAATATACAAATGGACAATGG + Intronic
1097311515 12:58124037-58124059 ATGACTTTAAAAATGGGCAATGG + Intergenic
1097519831 12:60653376-60653398 ATTGATTTATAAATTGTCTATGG + Intergenic
1097687172 12:62702008-62702030 ATGGATGAATGAATGAACAAAGG + Intronic
1097769441 12:63564956-63564978 AAGGATTTTTAAATGAAGAAGGG - Intronic
1097960184 12:65524644-65524666 AAGGAAATATAAATGGAGAATGG - Intergenic
1098245248 12:68510556-68510578 ATGGTTTTATTTATGGACACTGG - Intergenic
1098259543 12:68654130-68654152 AGGGATTTATACATGAAAAATGG + Exonic
1098648561 12:72937399-72937421 ATGGACTAATACATAGACAAAGG - Intergenic
1098991871 12:77072513-77072535 AGGGAAATATTAATGGACAAAGG + Intergenic
1099033160 12:77554260-77554282 ATGTATTTATATATGCACTAGGG + Intergenic
1099212188 12:79804932-79804954 ATGGAATCATAGATGTACAAAGG - Intronic
1099514426 12:83579534-83579556 AAGGATATATTAATGTACAAAGG + Intergenic
1100111640 12:91251165-91251187 ATGGACTGATAAATGAATAAAGG - Intergenic
1101270742 12:103141489-103141511 ATGGATTGATGAATGGATAAAGG + Intergenic
1102711340 12:114930352-114930374 ATGATTTTTTAAATGGGCAAAGG - Intergenic
1103443494 12:120979848-120979870 ATAAATTTATAAATGGCAAAAGG + Intronic
1103751645 12:123168079-123168101 AGGGGTTGATAAATGGAAAATGG - Intronic
1103855606 12:123967895-123967917 ATGCATTTAGAAATGGACTGGGG + Intronic
1104034648 12:125089902-125089924 ATGGATGGATAGATGGATAATGG - Intronic
1104034698 12:125090204-125090226 ATGGATGGATAGATGGATAATGG - Intronic
1104072200 12:125355585-125355607 CTGAATATACAAATGGACAACGG - Intronic
1104356623 12:128092456-128092478 CTGAATATAAAAATGGACAATGG + Intergenic
1106807922 13:33330416-33330438 CTGGATTAAAAAATGGGCAAGGG - Intronic
1107107515 13:36661182-36661204 ATGTATTTTTAAATGGATGATGG - Intergenic
1107122149 13:36807685-36807707 ATGAAAGTATAATTGGACAAAGG + Intergenic
1107273681 13:38651956-38651978 ATAGATTTATAGTTGGAAAAGGG + Intergenic
1107579093 13:41762965-41762987 ATGGACTTATAAAAGAAGAACGG + Intronic
1107765312 13:43728049-43728071 TTGGATTTATAAAAGCCCAAGGG - Intronic
1108868092 13:54946480-54946502 AATGATCTATAAATGGAGAATGG - Intergenic
1109010296 13:56932545-56932567 ATGCATTTATATGTGGATAATGG + Intergenic
1109210458 13:59529460-59529482 ATGGATTTATAATTTGATCAAGG - Intergenic
1109665884 13:65536508-65536530 ATAGCTTTATAAAGGGAAAATGG - Intergenic
1110427673 13:75387273-75387295 AAGTATATATAAATGGAAAAGGG + Intronic
1110494787 13:76154736-76154758 AAGTATTTTTAAATGGACCAGGG + Intergenic
1112151564 13:96770279-96770301 ATGAATTTATTAATTGAAAATGG + Intronic
1112727064 13:102317019-102317041 ATGAATTAATGAATGGAAAATGG - Intronic
1112960766 13:105122712-105122734 ATGCATTTTTAAATAAACAATGG - Intergenic
1112965805 13:105192129-105192151 ATGGAATTCTTAATGGTCAAAGG + Intergenic
1113352747 13:109545343-109545365 ATGGATTTAGAATTGCAGAAAGG - Intergenic
1113659173 13:112093218-112093240 TTTCATTTATAAATGGACAGTGG - Intergenic
1114716794 14:24834827-24834849 ATGGATTTCTAAAGGGGGAAAGG + Intronic
1115003520 14:28451381-28451403 CTTGATTTAAAAATGGGCAAAGG - Intergenic
1115049635 14:29042066-29042088 ATGGATGAATAAATGAATAAAGG + Intergenic
1115363849 14:32534103-32534125 CTGTATTTAAAAATGTACAAGGG - Intronic
1116043117 14:39710046-39710068 CTGGAGTTAAAAATGGAGAAAGG - Intergenic
1116102421 14:40457327-40457349 TTGGATTAATAAATGAACATTGG + Intergenic
1117128501 14:52659212-52659234 ATGAATTTAAAAATTCACAAAGG + Intronic
1117293618 14:54358015-54358037 ACCTATTTAAAAATGGACAAAGG - Intergenic
1118078923 14:62335670-62335692 ATGGATGTATAATTTGATAATGG + Intergenic
1118371669 14:65142528-65142550 ATGTATTTATAAGAGGAAAATGG + Intergenic
1120374588 14:83686446-83686468 CCAGATTTAAAAATGGACAAAGG + Intergenic
1120656256 14:87193608-87193630 ATGGATGGATGAATGGATAATGG + Intergenic
1120660350 14:87240823-87240845 ATGGGTTGATAAAAGAACAAGGG - Intergenic
1121687786 14:95851673-95851695 ATTGATGGATAAATGGATAAAGG + Intergenic
1122012619 14:98763674-98763696 ATGGATATAAAAATTGACAAAGG + Intergenic
1122274266 14:100583387-100583409 ATGGATACATAAATGGATACAGG - Intronic
1122988369 14:105224064-105224086 ATGGATTTTTAAAGGCAAAAAGG - Intronic
1124425731 15:29560943-29560965 ATTCATTTATAAATGGTCTATGG + Intronic
1125267129 15:37895684-37895706 ATGGATATTTTAATGGACTAGGG + Intergenic
1126168863 15:45677236-45677258 ATGGATAGATAGATAGACAAAGG - Intronic
1126769317 15:52039396-52039418 ATGGCTTTTTAAATGGCCAAAGG + Intronic
1127229928 15:56980043-56980065 CTTGACTTATAAATGAACAATGG - Intronic
1127384373 15:58455123-58455145 CTGTATTTATACATGGACATTGG + Intronic
1128571109 15:68733494-68733516 ATGTATATATAAATGGCCAGAGG + Intergenic
1129078511 15:73019064-73019086 TTGGTTTTATAATTTGACAAAGG + Intergenic
1129941810 15:79503980-79504002 ATTGATTTATAAATGGTCTTGGG + Intergenic
1130402872 15:83573752-83573774 ATGAATAAATAAATGAACAAAGG - Intronic
1131432203 15:92395831-92395853 ATGTTTTTATAACAGGACAATGG - Intronic
1131812987 15:96192380-96192402 ATGTAATTAAAAATGGGCAAAGG - Intergenic
1133819623 16:9225123-9225145 ATGAAATTATAAATGATCAAAGG + Intergenic
1134848572 16:17461565-17461587 ATGGATGGATGAATGGACAGAGG + Intronic
1134911765 16:18033610-18033632 ATTCATTTATCAATGGACATTGG + Intergenic
1135055240 16:19226617-19226639 ATGGAGTTACAAATAGACAAGGG + Intronic
1135528843 16:23235087-23235109 ATTGATGTAAAAATGGATAAGGG - Intergenic
1137034543 16:35558596-35558618 ATGGGTTTATATAAGCACAAAGG - Intergenic
1137517033 16:49154804-49154826 ATTAATTTAAAAATGGACAGAGG + Intergenic
1137823948 16:51473382-51473404 ATAAATTTTTAAATGAACAAAGG - Intergenic
1137882274 16:52062485-52062507 AGGGGTTTAAAAATGGAAAAGGG - Intronic
1138326495 16:56175676-56175698 CTCAATTTAAAAATGGACAAAGG - Intergenic
1138350356 16:56343146-56343168 ATGCATGTATAAAAGGAAAATGG + Intronic
1138407580 16:56810029-56810051 ATGTAATTATAAATTGATAATGG + Intronic
1138636589 16:58344032-58344054 CCAGATTTAAAAATGGACAAAGG - Intronic
1139148859 16:64355913-64355935 TTTGATTTATAAATTGACACTGG - Intergenic
1139799775 16:69512945-69512967 ATGAATTGATAAATGGATATAGG + Intergenic
1140235151 16:73152364-73152386 ATGGATTTAAACATTGACAATGG - Intergenic
1140716519 16:77730910-77730932 AAAAATTTAAAAATGGACAAAGG - Intronic
1140917139 16:79504591-79504613 ATGGATGGATAAATGGATAGAGG + Intergenic
1141591836 16:85074273-85074295 ATGTATATATAAATGGAATATGG - Intronic
1141658065 16:85426598-85426620 ATGGATGGATAAATGGAAGAAGG + Intergenic
1142793363 17:2287224-2287246 AACAATTTTTAAATGGACAAAGG + Intronic
1143343318 17:6231416-6231438 ATACATTTAAAAATTGACAAAGG + Intergenic
1145738221 17:27248754-27248776 ATCCAATTATAAATGGGCAAAGG - Intergenic
1146431474 17:32799867-32799889 ATCTATTTAAAAATGGGCAAAGG + Intronic
1146676853 17:34779691-34779713 ATGGATGGATGAATGGACACTGG - Intergenic
1147682244 17:42257688-42257710 ATGGAGTTAAAAATTCACAATGG + Intronic
1147977503 17:44256183-44256205 ATGGATGAATAGATGGATAATGG - Intronic
1150975091 17:70076958-70076980 TTCCATTTATAAATGGAAAATGG - Intronic
1151045124 17:70910909-70910931 CTGAATTAATAAACGGACAAAGG + Intergenic
1151927973 17:77212801-77212823 ATTGTTTTTAAAATGGACAAAGG - Intronic
1153617854 18:6951099-6951121 ATGGATGTGTAAATGGATGAAGG - Intronic
1153690419 18:7586889-7586911 ATATATTTTTAAATGGACAATGG - Intronic
1154137557 18:11793621-11793643 AATAATTTAAAAATGGACAAAGG + Intronic
1154289762 18:13097325-13097347 AAGAGTTTATAAGTGGACAATGG - Intronic
1154968001 18:21378843-21378865 ATTAATTTAAAAATGGGCAATGG - Intronic
1155068345 18:22288509-22288531 ATGGAAATACAAATGGCCAAGGG - Intergenic
1155874656 18:31070894-31070916 ATGAAGTTATAAATGTACAATGG + Intronic
1155919269 18:31586716-31586738 ATGGCTATTTACATGGACAAGGG + Intergenic
1155947583 18:31873349-31873371 ATCGTTTTTTAAATGGAGAAAGG + Intronic
1156044604 18:32863301-32863323 ATGGATTTATAAATATATAGAGG - Intergenic
1156194380 18:34757250-34757272 TTGGATTTGTAACTGCACAAAGG - Intronic
1157139117 18:45088106-45088128 CTGAATATACAAATGGACAATGG + Intergenic
1157602055 18:48899576-48899598 ATCAATTTTTAAATGGGCAAAGG + Intergenic
1158131758 18:54159790-54159812 ATGGATATTGAAATGGACAGTGG - Exonic
1158637096 18:59169207-59169229 AAATATTTTTAAATGGACAATGG + Intergenic
1158789128 18:60754447-60754469 CTGAATATACAAATGGACAAGGG + Intergenic
1159100504 18:63952814-63952836 ATGTTTTTATAAATGGAGGAAGG - Intronic
1159472024 18:68869169-68869191 TTGGATTTATGAATGTAGAAAGG + Intronic
1159753254 18:72328986-72329008 ATGAATTCATAAAAGGAAAATGG + Intergenic
1161258539 19:3322991-3323013 GTGGATGGATAGATGGACAAAGG + Intergenic
1161879113 19:6934935-6934957 CTGGATATACAAATAGACAAGGG - Intronic
1162424746 19:10587715-10587737 ATGGATGGATGAATGGATAATGG - Intergenic
1164124865 19:22304011-22304033 AGGGATTTATAAGTGTAGAAAGG + Intronic
1164666027 19:30037729-30037751 ATGGCTTGATTAATGGAAAAGGG - Intergenic
1165173336 19:33908553-33908575 ATGGATTGATATATGGATAGAGG - Intergenic
1165203340 19:34163213-34163235 ATGGATTTAAATATGGCCAAAGG + Intergenic
1167233919 19:48302508-48302530 ATGGATGGATAGATGGACATGGG + Intronic
1168077532 19:53989734-53989756 ATGGATGGATGAATGGGCAAAGG - Exonic
1168508251 19:56954494-56954516 ATGGATGGATGAATGGATAATGG - Intergenic
925256064 2:2489744-2489766 ATGGTTTTATAAAGGGACACAGG - Intergenic
926267584 2:11339233-11339255 ATGTATTGATAGATGGATAAAGG + Intronic
926805138 2:16702069-16702091 GTGCATTTAAAAATGCACAATGG + Intergenic
927906970 2:26865611-26865633 ATGCATTTAAAAATGGACACAGG - Intronic
928982738 2:37153723-37153745 ATTCATTTATGAATGGACACTGG + Intronic
929466186 2:42146427-42146449 AGTGATTAATAAATGGACACTGG + Intergenic
930976175 2:57464356-57464378 GTTGATTAATAAATGGACTAAGG - Intergenic
931136502 2:59408163-59408185 AAGATTTTAAAAATGGACAAGGG + Intergenic
932082616 2:68729051-68729073 ATAGATTTGTGTATGGACAAAGG - Intronic
932397281 2:71456631-71456653 ATGAATGTATACATGCACAAAGG - Intronic
932652001 2:73567932-73567954 ATCAATTTATAAATGAATAATGG + Intronic
932865351 2:75335675-75335697 CTGAATATACAAATGGACAATGG - Intergenic
932892082 2:75606149-75606171 ATGGGTGGATAGATGGACAAAGG + Intergenic
933178002 2:79197546-79197568 TTGAATATACAAATGGACAATGG - Intronic
933207641 2:79527181-79527203 CTAAATTTAAAAATGGACAAAGG + Intronic
933486522 2:82931691-82931713 ATGTATGTATAAATGCAAAATGG + Intergenic
934910874 2:98253293-98253315 ATGGATTTATGATTACACAAAGG - Intronic
935199683 2:100845417-100845439 CTGAATGTACAAATGGACAATGG - Intronic
935514141 2:104013839-104013861 ATGGAGGAATAAAAGGACAAAGG - Intergenic
935782981 2:106524270-106524292 ATGAATATACAAAGGGACAATGG - Intergenic
935995842 2:108772004-108772026 ATGTATGTGTAAATGGTCAATGG + Intronic
936034318 2:109098588-109098610 TTGGTTTTATAAACAGACAAAGG - Intergenic
936756046 2:115713876-115713898 CTGGCTTTATAAATGGATGATGG - Intronic
936790985 2:116151709-116151731 ACTGATTAATAAATGGGCAAAGG - Intergenic
936949686 2:117965479-117965501 ATGGGGTTAGAAATGGAAAAGGG - Intronic
937200417 2:120200437-120200459 ATGGATGGATAAATATACAATGG + Intergenic
937391559 2:121492501-121492523 TTCGATTTTTAAGTGGACAAAGG + Intronic
938108156 2:128547180-128547202 ATGGATGGATAGATGGAGAATGG - Intergenic
939139667 2:138339327-138339349 ATGGATTTTAAAATGCTCAAGGG + Intergenic
939828923 2:147049212-147049234 AAGGAATTGTTAATGGACAAGGG - Intergenic
939995680 2:148917070-148917092 AAGGAATTAAAAATGGGCAAAGG - Intronic
940376154 2:152961269-152961291 ATGGTTTTATAAAATGAGAATGG + Intergenic
940863746 2:158796246-158796268 ATGTTTTTGTAAATGGAGAAAGG - Intronic
941385908 2:164851739-164851761 ATTGATGGATAAATGGATAAAGG - Intergenic
943252417 2:185544306-185544328 ATGGATATATAAATGGTGATTGG + Intergenic
943720086 2:191194814-191194836 ATGGATAGATAAATGGAAGAAGG - Intergenic
943892918 2:193313872-193313894 ATGGATAGAAAAATGGAAAAGGG - Intergenic
943956864 2:194202813-194202835 ATCCATTAAAAAATGGACAATGG - Intergenic
943976519 2:194485391-194485413 GAGGATTTAAAAATGGAAAAGGG + Intergenic
944027552 2:195189794-195189816 ATGGCTTTAAAAATAGAGAAAGG + Intergenic
944115735 2:196184417-196184439 ATGGATGAAAGAATGGACAAAGG + Intergenic
944345623 2:198661697-198661719 ATTTATATATAAATGGAAAAAGG - Intergenic
944353848 2:198761712-198761734 ACTGATTTATAAATGTACAATGG + Intergenic
944879953 2:204002601-204002623 ATGGATTTAGAAAAGAAGAAAGG + Intergenic
945423841 2:209674122-209674144 ATGGCTATGTTAATGGACAAGGG - Intronic
945616925 2:212082804-212082826 ATGCATTTATAAATGCATATTGG + Intronic
945728687 2:213505760-213505782 AGGGATTTCTAAAAGGATAATGG - Intronic
946636918 2:221739558-221739580 ATAATTTTAAAAATGGACAAAGG + Intergenic
947092758 2:226531313-226531335 ATAGATTTTTACAAGGACAAAGG + Intergenic
947476357 2:230451461-230451483 ACAGATTTTTAAATGGGCAAAGG - Intronic
948711792 2:239829713-239829735 ATGGATTTAGAAAAGGAAAGAGG - Intergenic
1169026043 20:2372311-2372333 ATGCATTTATAAAAGGATAAAGG + Intergenic
1169727360 20:8750519-8750541 ATGGATAGATAAATGGATAGAGG - Intronic
1170073186 20:12391118-12391140 ATGTATTTTTAAATGGCTAATGG - Intergenic
1170662771 20:18359048-18359070 AGGCATTTAAAAATAGACAATGG + Intergenic
1170819410 20:19743658-19743680 CTGAATATATAAAGGGACAATGG + Intergenic
1172051854 20:32123643-32123665 ATGTATATATAAATGTATAAGGG - Intronic
1172783316 20:37450184-37450206 ATGGATGAATGGATGGACAAAGG - Intergenic
1173015062 20:39217684-39217706 ATAAATTTAAAAATGGATAAAGG - Intergenic
1175745840 20:61456399-61456421 AGGGATTTATAAATGCCCACTGG - Intronic
1175747588 20:61469381-61469403 CTGGTTTTTTAAATGGGCAAAGG - Intronic
1175817351 20:61890245-61890267 ATGGATGCATAGATGGATAATGG + Intronic
1175817390 20:61890444-61890466 ATGGATGGATAAATGGATGATGG + Intronic
1176926060 21:14750324-14750346 ATGGAATAAGAAATGGACAAAGG + Intergenic
1177380278 21:20331569-20331591 ATGGATTTATTATTGGACTATGG + Intergenic
1177450945 21:21265718-21265740 ATGGATATATAGGTGGACATTGG + Intronic
1177841774 21:26242455-26242477 CCTGATTTAAAAATGGACAAAGG - Intergenic
1177854439 21:26385236-26385258 AAGTATGTATAAATGGACACAGG + Intergenic
1178183681 21:30194213-30194235 CTGGACATATAAGTGGACAATGG - Intergenic
1178215723 21:30595586-30595608 CTGGATTTAGAAATTGACAAAGG - Intergenic
1179474340 21:41633678-41633700 ATGGATGGACAAATGGATAATGG - Intergenic
1179623649 21:42634720-42634742 GTGGATGAATAGATGGACAATGG - Intergenic
1179623676 21:42634944-42634966 GTGGATGAATAGATGGACAATGG - Intergenic
1179623690 21:42635050-42635072 GTGGATGAATAGATGGACAATGG - Intergenic
1179623732 21:42635384-42635406 GTGGATGAATAGATGGACAATGG - Intergenic
1179623759 21:42635604-42635626 GTGGATGAATAGATGGACAATGG - Intergenic
1181729801 22:24836754-24836776 CTGAATTCAAAAATGGACAAAGG - Intronic
1182048530 22:27295900-27295922 ATGGATGGATAAATGGACAGTGG + Intergenic
1182308923 22:29390899-29390921 AAGGATTTAAAAATGGAATAAGG - Intronic
1183155069 22:36068539-36068561 ATCAATTTAAAAATGGGCAAAGG + Intergenic
1183923380 22:41187198-41187220 ATAGTTTTTTAAATGGGCAAAGG + Intergenic
1184421921 22:44387117-44387139 ATGGATTTATACATGGAGATGGG + Intergenic
1184621865 22:45686076-45686098 ATGGATTTCTTAATGGGAAAGGG + Intronic
949809126 3:7987203-7987225 AGGAATTACTAAATGGACAAAGG + Intergenic
950826466 3:15827891-15827913 ACAAATTTTTAAATGGACAAGGG + Intronic
951649810 3:24938656-24938678 AAAGTTTTATAAATGGACAGTGG - Intergenic
951977026 3:28522468-28522490 ATGGATTTATAAATGGACAAAGG + Intronic
952088729 3:29858193-29858215 ATGAATTAAAAAATGGAAAAAGG - Intronic
953097503 3:39792979-39793001 CTGAATTTACAAATGGACAATGG - Intergenic
953375449 3:42424383-42424405 CTGAATATATAAATGGATAATGG - Intergenic
953715380 3:45312938-45312960 ATGAATATATGAATGGATAATGG + Intergenic
955160083 3:56456730-56456752 ATTAATTTATAAGTGGAAAATGG - Intronic
955176368 3:56618142-56618164 ATGGATAGATAAATGCAGAAAGG - Intronic
955382354 3:58449797-58449819 AACTATTTAAAAATGGACAAAGG - Intergenic
955557848 3:60157196-60157218 ATGGATTGAAAAATGCAAAAGGG + Intronic
955581196 3:60424931-60424953 ATGGATTAATAAATCAAAAAGGG + Intronic
955661707 3:61306603-61306625 ACAGATTTAAAAATGGCCAAAGG - Intergenic
955711606 3:61785037-61785059 ATGCATTTATAAATAGCTAAGGG + Intronic
956329312 3:68087647-68087669 ATGGATGGATATATGGACAAAGG - Intronic
956608546 3:71098359-71098381 ATGGATTAGCAAATGTACAAAGG + Intronic
956744184 3:72298595-72298617 ATGGATTTATAAAAAGAGAAAGG + Intergenic
956809519 3:72850855-72850877 ATGGATGTAGAAATAGAAAAGGG - Intronic
956819257 3:72938225-72938247 ATGGATGTATAGATGGATAGGGG + Intronic
956900830 3:73714292-73714314 ATGGATTAAGAGATGGAGAAAGG - Intergenic
957129035 3:76199564-76199586 ATGAATGTACAAATGGATAATGG + Intronic
957427448 3:80057378-80057400 ATTGATTTAAAAATTGGCAAAGG + Intergenic
957530505 3:81435024-81435046 AGTGATTTAAAAATGGGCAAAGG + Intergenic
958001241 3:87751694-87751716 ATGGATAGAAAAATGGACAATGG + Intergenic
958863738 3:99475539-99475561 ATGGATTATAAAATTGACAAAGG - Intergenic
959443580 3:106409423-106409445 ATGAATCTATAAATGGAAGATGG - Intergenic
959629165 3:108489088-108489110 CTGGATTAAAAAATGGATAAAGG - Intronic
960623381 3:119657510-119657532 AAGGATGAATAAATGAACAAAGG + Intronic
961142664 3:124568168-124568190 CTAAATTTAAAAATGGACAAAGG + Intronic
961398791 3:126618887-126618909 TTTGATTTAAAAATGGGCAAAGG + Intronic
961418295 3:126778586-126778608 ATCCAATTAAAAATGGACAAAGG - Intronic
962543932 3:136412238-136412260 ATGAATGAATAAATGGAGAAAGG + Intronic
962653891 3:137523042-137523064 AAGTATTTAAATATGGACAATGG - Intergenic
962941918 3:140132922-140132944 AAGGATTTTTAAATGGAGATGGG + Intronic
963685275 3:148425605-148425627 ACAAATTTTTAAATGGACAAAGG + Intergenic
963812473 3:149792202-149792224 GTGCATTTAAAAATGTACAAAGG - Intronic
965655818 3:170983564-170983586 CCCGATTTAAAAATGGACAAAGG - Intergenic
966174224 3:177118009-177118031 AAAGATTTATAAATGGCCATTGG - Intronic
966265326 3:178034495-178034517 ATGGACTTATAAATCAACATGGG - Intergenic
966508894 3:180738437-180738459 ATAGATCTATAAATGGAAAGAGG - Intronic
966563607 3:181350903-181350925 CTAGATATATAAATGGAAAAGGG + Intergenic
966590585 3:181678295-181678317 AAGGACATAAAAATGGACAATGG - Intergenic
968168165 3:196485575-196485597 ATGGAATAATAAATGGAATAGGG - Intronic
970140122 4:12973165-12973187 TATGAGTTATAAATGGACAAAGG - Intergenic
970614312 4:17753596-17753618 AGGGCTTTAAAAATGGACTAGGG + Intronic
970688636 4:18596864-18596886 ATGGATGGATAAATGGAAACAGG + Intergenic
971668091 4:29519023-29519045 ATTGAATTATAAATGAAAAATGG - Intergenic
971787068 4:31118191-31118213 ATGGATTTTTAAAAGAACCATGG - Intronic
973587917 4:52410837-52410859 GTGAATATATAAATGGACAATGG - Intergenic
974862793 4:67544078-67544100 ATAGATTTTTAAATGAAGAAAGG - Intronic
976481200 4:85547890-85547912 ATGGAATTACAAATTAACAATGG - Intronic
976851771 4:89555784-89555806 CTGGATTTTAAAATGGGCAAAGG - Intergenic
977009082 4:91613001-91613023 ATGGAGCAAAAAATGGACAATGG + Intergenic
977451332 4:97201733-97201755 ATGGATTAATAAAAGAAAAATGG - Intronic
977492796 4:97735861-97735883 CTCGATTTAAAAATGGGCAAAGG + Intronic
977998124 4:103520678-103520700 ATGGTTTCATGAATGGAAAATGG - Intergenic
978057103 4:104283762-104283784 ATGGAGTTATGATTAGACAAGGG - Intergenic
978096453 4:104784855-104784877 ATGGATTTATAAACGCCAAAGGG - Intergenic
978155679 4:105487083-105487105 ATAAATTTTTAAATGAACAATGG + Intergenic
979044670 4:115847676-115847698 ATGGATTTATAAAATGATATGGG + Intergenic
979520369 4:121659403-121659425 AAAGATTTATGAATGGTCAAAGG - Intergenic
979695671 4:123610467-123610489 TAGGATTTATAAATGCACACTGG + Intergenic
979734442 4:124065055-124065077 ATGGAATTTTAAAGGGAGAATGG - Intergenic
979741005 4:124150994-124151016 ATGGTCATATAAATGGAGAAAGG + Intergenic
979967548 4:127093466-127093488 ATCCATTTAAAAATGGGCAAAGG + Intergenic
980309728 4:131110859-131110881 ATGGATTTTTGAATGGAGAAAGG + Intergenic
980332574 4:131428429-131428451 ATAAATGTATAAATGGCCAAGGG - Intergenic
980475236 4:133305475-133305497 ACTGATTTAAAAATGGGCAAAGG - Intergenic
980696048 4:136356808-136356830 TTGGCTTTAAAAATGGAAAAAGG + Intergenic
981995041 4:150964848-150964870 ATGAATTTAAAAATGAGCAAAGG + Intronic
982173460 4:152683404-152683426 CTGGATGTACAAATGGACAGTGG - Intergenic
982289981 4:153770306-153770328 CTCAATTTAAAAATGGACAAAGG - Intergenic
983105859 4:163684903-163684925 ATACATTTATGAATGGATAAAGG - Intronic
983332694 4:166351650-166351672 AAGGATAAATAAATGGATAATGG - Intergenic
983477153 4:168227815-168227837 ATTAATTTATAAATACACAAAGG - Intronic
983779906 4:171655662-171655684 ATATATTTACAAATGCACAATGG - Intergenic
984576131 4:181450450-181450472 AAGGATTTTTAAATGAAAAAGGG + Intergenic
984823157 4:183901757-183901779 CTAGATTCAAAAATGGACAAAGG - Intronic
986190098 5:5488720-5488742 AAGCATTTATAAATGGACTTTGG - Intronic
986288681 5:6380094-6380116 AGAAATTTATAAATGGGCAAAGG + Intergenic
986399474 5:7366417-7366439 ATGGATATACAGATGGAAAAGGG - Intergenic
986463767 5:7999885-7999907 ATCTATTTAAAAATGGGCAAAGG - Intergenic
986622874 5:9693695-9693717 ATGGTATTATTACTGGACAAGGG - Intronic
986887677 5:12260041-12260063 ATGGATGAATAATTGGAAAATGG - Intergenic
987203438 5:15600595-15600617 ATTGTTTGATAAATGGGCAATGG + Intronic
987564569 5:19567311-19567333 AATAATTTATAAAAGGACAATGG + Intronic
987729489 5:21750008-21750030 ATGTATTTATAAATGAATAACGG + Intergenic
988861508 5:35285325-35285347 ATGGATATATACATGAACTATGG + Intergenic
989289394 5:39745664-39745686 ATATATTTATAAATGTATAATGG + Intergenic
989403037 5:41029294-41029316 CCTGATTTAAAAATGGACAAAGG - Intronic
990199809 5:53358706-53358728 ATGTATTTATAAATGCAAACTGG - Intergenic
990920137 5:60954906-60954928 ATTGATTTTAAAATGGGCAAAGG - Intronic
991162056 5:63514762-63514784 ACAGATTTATAAATGCAAAATGG + Intergenic
991222048 5:64227915-64227937 ATGGTTTTAAAAATGGGTAAGGG - Intronic
991552252 5:67851945-67851967 ATGATTTTGTAAATGGATAAAGG + Intergenic
991651543 5:68860289-68860311 GTGGATTTTTTAATGGGCAAAGG + Intergenic
992192733 5:74309815-74309837 ATGGATTTCTAAATGAAGATGGG - Intergenic
992374386 5:76173960-76173982 AGGGATTTATACATGAAAAATGG - Intronic
992433141 5:76729328-76729350 CCTGATTTAAAAATGGACAAAGG - Intronic
993419885 5:87687794-87687816 ATAGTTTAAAAAATGGACAAAGG - Intergenic
994297294 5:98105885-98105907 ATTGGTTTTTAAATGAACAAAGG - Intergenic
994319386 5:98374502-98374524 GGGGATTTACAAATGAACAAAGG - Intergenic
994494642 5:100495901-100495923 ATGGATTAATGAATGGAAAGAGG + Intergenic
995506649 5:112867777-112867799 AAATATTTTTAAATGGACAATGG + Exonic
995626743 5:114087097-114087119 ATCCATTTAAAAATGGGCAAAGG - Intergenic
995704867 5:114977844-114977866 CTGATTTTATAAATGGGCAAAGG + Intergenic
996216403 5:120871860-120871882 ATGGATTTATAGAGGAAGAAAGG - Intergenic
996307702 5:122068816-122068838 ATGAATAAATAAATGGAGAATGG + Intronic
996857952 5:128030966-128030988 ATGGATTAATACATGAACCAAGG + Intergenic
997194828 5:131972042-131972064 ATTGATTTATACATGAAAAAAGG - Intronic
998928218 5:147151406-147151428 CCTGATTTAAAAATGGACAAAGG + Intergenic
999333087 5:150691356-150691378 ATGGACATAAAAATGGTCAAAGG + Exonic
999560954 5:152802271-152802293 GTGGAATTATAAATAGAAAAAGG + Intergenic
999912236 5:156215498-156215520 CCTGATTTACAAATGGACAAAGG + Intronic
1000116593 5:158159752-158159774 ATGGAGTAATGAAAGGACAAGGG + Intergenic
1000152129 5:158513555-158513577 ATTTATTTATGAATGAACAATGG + Intergenic
1000589125 5:163136985-163137007 ATGAATTTATAAAAGGAAAGAGG + Intergenic
1000760158 5:165213717-165213739 TTGGATTTATGAATGAATAAAGG + Intergenic
1001872867 5:175171882-175171904 ATGGATGAATAAATTGATAATGG - Intergenic
1002962950 6:1933692-1933714 TCCGATTTAAAAATGGACAAAGG - Intronic
1003010769 6:2425347-2425369 CTGATTTTAAAAATGGACAAAGG - Intergenic
1004332419 6:14734069-14734091 CTGAATATACAAATGGACAACGG + Intergenic
1004794947 6:19071004-19071026 ATTAATATATAAATGGAGAAAGG + Intergenic
1005163963 6:22897805-22897827 ATGGATCTTAAAATGGACAGGGG + Intergenic
1005769756 6:29055849-29055871 ATTGATTTTTAAACGGCCAAAGG - Intergenic
1005925952 6:30445875-30445897 ATGGATTTACAAATGTAGGAAGG - Intergenic
1006778359 6:36614357-36614379 ATGTATTTAAAAATGTACAGGGG - Intergenic
1006888126 6:37399421-37399443 ATGGATGTATAGATGGTCACTGG + Intergenic
1007283887 6:40733616-40733638 ATGGATTAATAGATGAATAAGGG + Intergenic
1007676778 6:43602421-43602443 ATGGATTTATAAAAAGGCATGGG + Intronic
1008306057 6:49901478-49901500 ATGGATTTTTGATTGCACAAGGG + Intergenic
1008378181 6:50814862-50814884 CTGGATTTATAAGTAGGCAAAGG - Intergenic
1009559928 6:65226447-65226469 ACCAATTTAAAAATGGACAAGGG + Intronic
1009591592 6:65678774-65678796 ATCCAATTATAAATGGGCAAAGG + Intronic
1009907344 6:69886148-69886170 TCTGATTTAAAAATGGACAAAGG + Intronic
1011331718 6:86215346-86215368 ATGGAGTTGTTAATGGAAAATGG + Intergenic
1011368481 6:86606416-86606438 CTCGATTTAAAAATGGGCAAAGG + Intergenic
1011447870 6:87462209-87462231 CTGAATATACAAATGGACAAAGG - Intronic
1011792036 6:90908862-90908884 ATAGAGATATAAAAGGACAAAGG - Intergenic
1011803093 6:91040504-91040526 ATGGATTTATCAAGAGAGAATGG - Intergenic
1012197781 6:96365987-96366009 ATATTTTTAAAAATGGACAAAGG + Intergenic
1012234211 6:96793697-96793719 ATGGATTTATAAGTACAGAAAGG + Intergenic
1012453479 6:99378905-99378927 ATGAATACATAAATGGACAGAGG + Intronic
1012990123 6:105916856-105916878 ATAGATTGATAAATGGATAGAGG + Intergenic
1013462636 6:110389963-110389985 CTGAATGTACAAATGGACAATGG - Intergenic
1013515357 6:110880217-110880239 AGTGATTAAAAAATGGACAAAGG - Intronic
1013848757 6:114487626-114487648 ATCCATTAAAAAATGGACAAAGG - Intergenic
1013906832 6:115230711-115230733 ATGGTTTTATAGATAGAAAATGG - Intergenic
1013943958 6:115700065-115700087 CTTGATTTAAAAATGGATAAAGG - Intergenic
1014040865 6:116823446-116823468 ATGGTGATATATATGGACAATGG - Intronic
1014683798 6:124469401-124469423 ATGCATATATTAATGGACCATGG + Intronic
1014767264 6:125421307-125421329 CTGAATATATAAATGGACAATGG - Intergenic
1014782576 6:125581696-125581718 ATGAATTTATAAAAGTACATGGG - Intergenic
1014826036 6:126049595-126049617 ATGGATTTAAATAATGACAAAGG + Intergenic
1015482915 6:133734095-133734117 ACCCATTTAAAAATGGACAAAGG + Intergenic
1015731632 6:136354020-136354042 TTGGCTTTATAAATGAACAAGGG + Intronic
1016273416 6:142318686-142318708 ATGGATCTAGAAATGGAGAAGGG + Intronic
1016601064 6:145861262-145861284 TTTGATTTAAAAATGGGCAAAGG + Intergenic
1016679347 6:146810126-146810148 CTGGTTTTAAAAATGGGCAAAGG + Intronic
1017349934 6:153428024-153428046 CTGGATATGTGAATGGACAATGG - Intergenic
1019848428 7:3529087-3529109 AGGGATTTATAAATGTGGAAAGG + Intronic
1021497119 7:21288155-21288177 CTTGATTTAAAAATGGGCAAAGG + Intergenic
1021610044 7:22448269-22448291 ATGCATTTCTATATGGCCAAAGG + Intronic
1021792659 7:24221590-24221612 AAGGATATACAAATAGACAATGG + Intergenic
1022134542 7:27435094-27435116 ATGGTTGTCTAAATGGACAATGG + Intergenic
1022367471 7:29737835-29737857 AAGGATTTTTAAATGAAGAAGGG + Intergenic
1022732642 7:33044664-33044686 ATGTCTTTATCAATGGAAAAAGG + Intronic
1022748610 7:33200504-33200526 TTGGATTCATAAAAGGACACTGG - Intronic
1022864133 7:34399726-34399748 ATGGATTTCTAAGGGGAGAAGGG + Intergenic
1024400346 7:48917544-48917566 ATTTATATATAAATGAACAAAGG - Intergenic
1024781198 7:52851201-52851223 TTGAATCTATAAATGGAAAATGG + Intergenic
1026048673 7:66926196-66926218 AGGGATTAAAAAATGGGCAAGGG - Intronic
1026681305 7:72468881-72468903 CTGAATTTAAAAATGGGCAAAGG - Intergenic
1027440505 7:78214384-78214406 ATTGATTTTTAAATGGAGGATGG - Intronic
1027911407 7:84256406-84256428 ATGGCTTTAAAAATGTCCAAAGG - Intronic
1027989713 7:85342313-85342335 ATGGATTTTTAACTTGATAAAGG + Intergenic
1028781899 7:94746754-94746776 CTGAATATACAAATGGACAATGG + Intergenic
1028824460 7:95254447-95254469 ATGGATTTTTAAATGTGGAATGG - Intronic
1029245718 7:99199893-99199915 TTTGACTTAAAAATGGACAAAGG + Intronic
1029448066 7:100625885-100625907 ATAGGTTTGTAAATGGCCAAGGG + Intronic
1029824830 7:103179728-103179750 AAGGATTTTTAAATGAAGAAGGG - Intergenic
1030350236 7:108476742-108476764 ATGGATGAATGAATGGATAAAGG + Intronic
1031313946 7:120233588-120233610 ATGGAATGATAAATGGCCCAAGG + Intergenic
1031599061 7:123682435-123682457 ATGGATATATAATTTGCCAAAGG - Exonic
1031789646 7:126085174-126085196 ATGTAATTATAGATAGACAATGG - Intergenic
1031939765 7:127775927-127775949 ATGTATTTATAAATTAACAAAGG + Intronic
1032607544 7:133372056-133372078 CTGAACTTAAAAATGGACAAAGG - Intronic
1032981625 7:137290506-137290528 ATGGAATTATAAATAAATAATGG + Intronic
1033110469 7:138569922-138569944 ATGACTTGATGAATGGACAAAGG - Intronic
1033388314 7:140900911-140900933 AGGGACTTATAAAAGGAAAAGGG - Intronic
1034061050 7:148090425-148090447 CTTGATTTAAAAATGGACAAAGG + Intronic
1036194544 8:6702418-6702440 ATAGATTTGTAATTGGAAAAAGG + Intergenic
1037123641 8:15319023-15319045 ATTGATTCAAAAATGGGCAAAGG - Intergenic
1037298439 8:17426006-17426028 ATGGATCTATATATGGATATAGG - Intergenic
1037629945 8:20646627-20646649 ATGGATTTATATGTGGACAATGG - Intergenic
1038852461 8:31293196-31293218 ATAAATTTAAAAATGGGCAAAGG - Intergenic
1039178897 8:34841193-34841215 ATTGAATCATAAATGTACAATGG - Intergenic
1041183835 8:55277230-55277252 ATGGATTTATAAATGATGGATGG - Intronic
1041240232 8:55842805-55842827 ATGGATTTTTAAATAGACTGTGG + Intergenic
1041562114 8:59229982-59230004 ATGCATTAACAAATGGGCAAAGG + Intergenic
1041621323 8:59973029-59973051 AGGGATTTATAAATAAATAAAGG + Intergenic
1041947057 8:63457278-63457300 ATGAAAATATAAATGTACAAAGG - Intergenic
1042054255 8:64746882-64746904 ATGGATTTATAAATGCAGATTGG - Intronic
1042794302 8:72643754-72643776 CTGGACTTATACATGAACAAAGG + Intronic
1043233092 8:77827203-77827225 ATAGTATTAAAAATGGACAAAGG - Intergenic
1043277985 8:78424827-78424849 ATGGATCTAGAAATTGATAAAGG - Intergenic
1043307376 8:78812718-78812740 CTTGATTTAAAAATGGGCAAAGG - Intergenic
1043932963 8:86111468-86111490 ATTGATGGATGAATGGACAAAGG - Intronic
1043964395 8:86456414-86456436 AAACATTTTTAAATGGACAAAGG + Intronic
1044001840 8:86892339-86892361 ATTAATTTATAAATGGACTTTGG - Intronic
1045628598 8:104087387-104087409 ATGGATGGATGGATGGACAAGGG + Intronic
1045776460 8:105809176-105809198 ATGGATTTATGAATGAATAATGG + Intergenic
1046154766 8:110273655-110273677 ATGAGTTGATAAATGGAAAATGG + Intergenic
1046314149 8:112478274-112478296 ATGGCTTTAGAAATGGGTAATGG + Intronic
1046373008 8:113336023-113336045 TTGGAATTATAAAAGGAGAAGGG - Intronic
1046542410 8:115603542-115603564 AAGGATAAATAAATGGACTACGG + Intronic
1046823137 8:118657335-118657357 ACAGATTTATAGCTGGACAATGG - Intergenic
1047223569 8:122938300-122938322 ATGGATTCATAACTGGACAAAGG - Intronic
1047815874 8:128461689-128461711 ATTTATTAATAAAGGGACAAAGG + Intergenic
1047911157 8:129531087-129531109 ATGGCTTTGGAATTGGACAATGG + Intergenic
1048413153 8:134196975-134196997 ATGGATAGAAGAATGGACAAGGG - Intergenic
1049464992 8:142747024-142747046 ATGGATAGATAAATGGATAGGGG + Intergenic
1049489297 8:142885443-142885465 CTGGATTAAAAAATGGACAAAGG - Intronic
1050373467 9:4946478-4946500 ATGGATTAATGGATGGACAGAGG - Intergenic
1050583700 9:7087748-7087770 ATGGAGTTATCAAATGACAATGG + Intergenic
1050637298 9:7626009-7626031 ATGGATTTAGACATGGTCTAAGG - Intergenic
1050941459 9:11464489-11464511 ACTGATTTAAAAATAGACAAAGG - Intergenic
1051980565 9:23010342-23010364 ATTTATTTATTAATGGACACAGG + Intergenic
1052518756 9:29515245-29515267 ATTGAATTATACATGGAAAATGG + Intergenic
1053183456 9:35993961-35993983 TTGAATTTGTAAATGGCCAAGGG - Intergenic
1055075827 9:72214047-72214069 ATGGAGTTAGAGATGGAAAAAGG + Intronic
1055222323 9:73951428-73951450 CTGCATTAATAAATGGGCAAAGG - Intergenic
1055576752 9:77667839-77667861 TAAGATTTAAAAATGGACAAAGG + Intergenic
1057740551 9:97707723-97707745 ATCAATTTTAAAATGGACAAAGG - Intergenic
1058247718 9:102650980-102651002 ATTCATTTATAAATGGGCATGGG - Intergenic
1058911780 9:109526808-109526830 ATGGATAAATAAGTAGACAAAGG + Intergenic
1059175996 9:112170663-112170685 CTGAATATACAAATGGACAATGG + Intronic
1059553013 9:115249453-115249475 AACGATTTAAAAATGGGCAAAGG - Intronic
1059968209 9:119637227-119637249 TTGAATATATAAATGGAAAATGG - Intergenic
1060329014 9:122647826-122647848 ATGGCTGAATAAATGGACAGTGG + Intergenic
1060985698 9:127817874-127817896 ATGGATGGATAGATGGACAGTGG + Intronic
1061417514 9:130455113-130455135 ATGGATGAATAAATGGATGATGG - Intronic
1185744350 X:2560044-2560066 ATGGATGTATATATGGATGATGG + Intergenic
1185874552 X:3691882-3691904 ATGGATGGATGGATGGACAATGG + Intronic
1186162522 X:6792645-6792667 ATAGAAGTATAATTGGACAAAGG - Intergenic
1187193481 X:17058664-17058686 ATGCATTTATACAGGAACAAGGG + Intronic
1187343729 X:18444224-18444246 ATGGTTCCATAAATGGAAAATGG - Intronic
1188020478 X:25151632-25151654 ATGGTATAATAAATGCACAAAGG - Intergenic
1188330765 X:28868498-28868520 ATGGTTATAGAAATGGAGAAGGG - Intronic
1188697289 X:33210421-33210443 AAGGATTTAAAAATGGACTGTGG - Intronic
1189615290 X:42777163-42777185 ATGGTTTTATAAAAGGAATATGG + Intergenic
1189760486 X:44316797-44316819 TTGAATTTAAAAATGGGCAAAGG + Intronic
1192065200 X:67877643-67877665 ATGATTTAAAAAATGGACAAAGG + Intergenic
1192085524 X:68092888-68092910 ATTCATTTATAAGTGGATAAAGG - Intronic
1192288346 X:69763135-69763157 ATGAATTCATAAAAGGACATAGG - Intronic
1192356884 X:70412457-70412479 ATGAATTTGTAAATGGCCAAAGG + Intronic
1192857597 X:75029664-75029686 ATTGATAAATAAATGGGCAAAGG + Intergenic
1192988182 X:76422998-76423020 TTGAATGTACAAATGGACAATGG - Intergenic
1193062240 X:77219582-77219604 ATGGAGTCAGAAATGGAGAATGG + Intergenic
1193136574 X:77978122-77978144 ATTGAAGTAGAAATGGACAATGG - Intronic
1193572317 X:83159871-83159893 ATTTTTTTATAAATGGCCAAGGG - Intergenic
1194001688 X:88437616-88437638 CTGAATACATAAATGGACAATGG + Intergenic
1194847793 X:98833103-98833125 ATTTATTTATAAACTGACAATGG + Intergenic
1196005232 X:110830324-110830346 ATGGATTGATGAATGGATAGCGG + Intergenic
1196239333 X:113323349-113323371 AAAGATTTAAAAATGGGCAAAGG + Intergenic
1196388052 X:115180173-115180195 AAGGATTTATAAATGTGCACTGG + Intronic
1196654797 X:118206467-118206489 ATGCATATATAAATGTACATGGG + Intergenic
1197221029 X:123914183-123914205 ATGTATATATATATGAACAATGG + Intergenic
1197900880 X:131370138-131370160 GTGGAATTAAAAATGTACAAAGG + Intronic
1198086727 X:133289418-133289440 ATTATTTTTTAAATGGACAAGGG + Intergenic
1198152921 X:133928757-133928779 CTTGATTTAAAAATGGGCAAAGG - Intronic
1198339467 X:135699912-135699934 ATTGATTTTTTAATGGATAAAGG + Intergenic
1198586384 X:138127127-138127149 ATGCATTTAAAAATGTACAGAGG + Intergenic
1199253787 X:145695400-145695422 ATGGCTCTATTAATGCACAATGG - Intergenic
1199396540 X:147345158-147345180 ATGGATTGATAAAAGAATAATGG + Intergenic
1199438324 X:147839905-147839927 TTGCATTTACAAATGTACAATGG - Intergenic
1199784630 X:151093471-151093493 ATGGATGGATGAATGGATAAAGG - Intergenic
1199787815 X:151120429-151120451 AAGGAATTATAAATGAACAATGG + Intergenic
1200362020 X:155617056-155617078 AAGAATGTATAAATGCACAAGGG - Intronic
1200723471 Y:6634559-6634581 ATGAATTAATAAATAGACAAGGG + Intergenic
1200781572 Y:7221058-7221080 ATGAATTGATAAATGTATAATGG + Intergenic
1201296598 Y:12468646-12468668 AGTGATTTTTAACTGGACAATGG - Intergenic
1201538538 Y:15080207-15080229 ATGTAGTTAAAAATGGATAACGG + Intergenic
1201625641 Y:16011923-16011945 ATGGAAAGATAAAAGGACAATGG + Intergenic
1201866526 Y:18661490-18661512 AAGGGTTTGAAAATGGACAAAGG + Intergenic
1202094015 Y:21225947-21225969 ATGCATTTATATATGAATAAAGG - Intergenic