ID: 951982426

View in Genome Browser
Species Human (GRCh38)
Location 3:28580399-28580421
Sequence ACGTGAAAGGCTCTGTGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951982420_951982426 13 Left 951982420 3:28580363-28580385 CCATTCTATTCCTTTAGTCTTTA No data
Right 951982426 3:28580399-28580421 ACGTGAAAGGCTCTGTGAGAGGG No data
951982423_951982426 3 Left 951982423 3:28580373-28580395 CCTTTAGTCTTTAAGGTGGTCTT No data
Right 951982426 3:28580399-28580421 ACGTGAAAGGCTCTGTGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951982426 Original CRISPR ACGTGAAAGGCTCTGTGAGA GGG Intergenic
No off target data available for this crispr