ID: 951984938

View in Genome Browser
Species Human (GRCh38)
Location 3:28608564-28608586
Sequence CCAACCAGGAGCACAACCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951984938_951984942 -2 Left 951984938 3:28608564-28608586 CCAGCGGTTGTGCTCCTGGTTGG No data
Right 951984942 3:28608585-28608607 GGGACCAGTGTTTGCTCTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951984938 Original CRISPR CCAACCAGGAGCACAACCGC TGG (reversed) Intergenic
No off target data available for this crispr