ID: 951986550

View in Genome Browser
Species Human (GRCh38)
Location 3:28627714-28627736
Sequence CCCAAACCCTTCAGTAATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951986545_951986550 12 Left 951986545 3:28627679-28627701 CCACAACACCTTAATCTAGGCAG No data
Right 951986550 3:28627714-28627736 CCCAAACCCTTCAGTAATGAAGG No data
951986547_951986550 4 Left 951986547 3:28627687-28627709 CCTTAATCTAGGCAGGACTACTG No data
Right 951986550 3:28627714-28627736 CCCAAACCCTTCAGTAATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951986550 Original CRISPR CCCAAACCCTTCAGTAATGA AGG Intergenic
No off target data available for this crispr