ID: 951987755

View in Genome Browser
Species Human (GRCh38)
Location 3:28639939-28639961
Sequence CAATATTTATGGAGTGTGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951987755_951987760 26 Left 951987755 3:28639939-28639961 CCCCACACACTCCATAAATATTG No data
Right 951987760 3:28639988-28640010 TAGCCAGAGGATGAATTATCTGG No data
951987755_951987759 13 Left 951987755 3:28639939-28639961 CCCCACACACTCCATAAATATTG No data
Right 951987759 3:28639975-28639997 TCAGTTCTTATGTTAGCCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951987755 Original CRISPR CAATATTTATGGAGTGTGTG GGG (reversed) Intergenic
No off target data available for this crispr