ID: 951988350

View in Genome Browser
Species Human (GRCh38)
Location 3:28646610-28646632
Sequence CCGGAAAAGCTGAGAGTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951988350_951988355 14 Left 951988350 3:28646610-28646632 CCTTGCACTCTCAGCTTTTCCGG No data
Right 951988355 3:28646647-28646669 TAGTTTCGATAATGGTGCCTGGG No data
951988350_951988353 6 Left 951988350 3:28646610-28646632 CCTTGCACTCTCAGCTTTTCCGG No data
Right 951988353 3:28646639-28646661 TATGTGTATAGTTTCGATAATGG No data
951988350_951988354 13 Left 951988350 3:28646610-28646632 CCTTGCACTCTCAGCTTTTCCGG No data
Right 951988354 3:28646646-28646668 ATAGTTTCGATAATGGTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951988350 Original CRISPR CCGGAAAAGCTGAGAGTGCA AGG (reversed) Intergenic
No off target data available for this crispr