ID: 951991577

View in Genome Browser
Species Human (GRCh38)
Location 3:28681039-28681061
Sequence CTGTATATGTATGTGTATCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951991571_951991577 10 Left 951991571 3:28681006-28681028 CCTATGTGCACATATGTGTATGG No data
Right 951991577 3:28681039-28681061 CTGTATATGTATGTGTATCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951991577 Original CRISPR CTGTATATGTATGTGTATCT AGG Intergenic
No off target data available for this crispr