ID: 951994035

View in Genome Browser
Species Human (GRCh38)
Location 3:28706901-28706923
Sequence ACCAGTGGATTCCCCAAATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951994035_951994038 11 Left 951994035 3:28706901-28706923 CCAGATTTGGGGAATCCACTGGT No data
Right 951994038 3:28706935-28706957 CTAACCACATTTTTCTTTCCTGG No data
951994035_951994040 20 Left 951994035 3:28706901-28706923 CCAGATTTGGGGAATCCACTGGT No data
Right 951994040 3:28706944-28706966 TTTTTCTTTCCTGGATTAAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951994035 Original CRISPR ACCAGTGGATTCCCCAAATC TGG (reversed) Intergenic
No off target data available for this crispr