ID: 951999409

View in Genome Browser
Species Human (GRCh38)
Location 3:28768534-28768556
Sequence CCATTAAATAAGTTTAAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951999407_951999409 -2 Left 951999407 3:28768513-28768535 CCATAGCAGCAAGATGAGAAACC No data
Right 951999409 3:28768534-28768556 CCATTAAATAAGTTTAAAGCAGG No data
951999406_951999409 10 Left 951999406 3:28768501-28768523 CCATTATTCAAACCATAGCAGCA No data
Right 951999409 3:28768534-28768556 CCATTAAATAAGTTTAAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951999409 Original CRISPR CCATTAAATAAGTTTAAAGC AGG Intergenic
No off target data available for this crispr