ID: 951999786

View in Genome Browser
Species Human (GRCh38)
Location 3:28772315-28772337
Sequence CCCACTGGGTACTCCTAGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951999786_951999794 7 Left 951999786 3:28772315-28772337 CCTGACTAGGAGTACCCAGTGGG No data
Right 951999794 3:28772345-28772367 CTGGTGGAGATGTGAGAAGAGGG No data
951999786_951999790 -9 Left 951999786 3:28772315-28772337 CCTGACTAGGAGTACCCAGTGGG No data
Right 951999790 3:28772329-28772351 CCCAGTGGGTCACTGCCTGGTGG No data
951999786_951999793 6 Left 951999786 3:28772315-28772337 CCTGACTAGGAGTACCCAGTGGG No data
Right 951999793 3:28772344-28772366 CCTGGTGGAGATGTGAGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951999786 Original CRISPR CCCACTGGGTACTCCTAGTC AGG (reversed) Intergenic
No off target data available for this crispr