ID: 952000144

View in Genome Browser
Species Human (GRCh38)
Location 3:28775698-28775720
Sequence ATCAAAAATGTCTCCAGGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952000144_952000146 -10 Left 952000144 3:28775698-28775720 CCATGCCTGGAGACATTTTTGAT No data
Right 952000146 3:28775711-28775733 CATTTTTGATTGTCACAACTTGG 0: 44
1: 255
2: 655
3: 913
4: 1334
952000144_952000148 26 Left 952000144 3:28775698-28775720 CCATGCCTGGAGACATTTTTGAT No data
Right 952000148 3:28775747-28775769 TGTGTGTTACTGATATCTAATGG No data
952000144_952000147 -9 Left 952000144 3:28775698-28775720 CCATGCCTGGAGACATTTTTGAT No data
Right 952000147 3:28775712-28775734 ATTTTTGATTGTCACAACTTGGG 0: 22
1: 106
2: 356
3: 723
4: 1216

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952000144 Original CRISPR ATCAAAAATGTCTCCAGGCA TGG (reversed) Intergenic
No off target data available for this crispr