ID: 952000275

View in Genome Browser
Species Human (GRCh38)
Location 3:28777322-28777344
Sequence AGTAAGCGCATGACCCAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952000275_952000283 21 Left 952000275 3:28777322-28777344 CCATGCTGGGTCATGCGCTTACT No data
Right 952000283 3:28777366-28777388 TCATGTGACTGGAGGGCTGGTGG No data
952000275_952000285 25 Left 952000275 3:28777322-28777344 CCATGCTGGGTCATGCGCTTACT No data
Right 952000285 3:28777370-28777392 GTGACTGGAGGGCTGGTGGAGGG No data
952000275_952000282 18 Left 952000275 3:28777322-28777344 CCATGCTGGGTCATGCGCTTACT No data
Right 952000282 3:28777363-28777385 CAATCATGTGACTGGAGGGCTGG No data
952000275_952000279 10 Left 952000275 3:28777322-28777344 CCATGCTGGGTCATGCGCTTACT No data
Right 952000279 3:28777355-28777377 GGAAATCACAATCATGTGACTGG No data
952000275_952000280 13 Left 952000275 3:28777322-28777344 CCATGCTGGGTCATGCGCTTACT No data
Right 952000280 3:28777358-28777380 AATCACAATCATGTGACTGGAGG No data
952000275_952000281 14 Left 952000275 3:28777322-28777344 CCATGCTGGGTCATGCGCTTACT No data
Right 952000281 3:28777359-28777381 ATCACAATCATGTGACTGGAGGG No data
952000275_952000284 24 Left 952000275 3:28777322-28777344 CCATGCTGGGTCATGCGCTTACT No data
Right 952000284 3:28777369-28777391 TGTGACTGGAGGGCTGGTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952000275 Original CRISPR AGTAAGCGCATGACCCAGCA TGG (reversed) Intergenic
No off target data available for this crispr