ID: 952000285

View in Genome Browser
Species Human (GRCh38)
Location 3:28777370-28777392
Sequence GTGACTGGAGGGCTGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952000275_952000285 25 Left 952000275 3:28777322-28777344 CCATGCTGGGTCATGCGCTTACT No data
Right 952000285 3:28777370-28777392 GTGACTGGAGGGCTGGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952000285 Original CRISPR GTGACTGGAGGGCTGGTGGA GGG Intergenic
No off target data available for this crispr