ID: 952001966

View in Genome Browser
Species Human (GRCh38)
Location 3:28796416-28796438
Sequence AAATTCACCTTGTCCAAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952001966_952001967 1 Left 952001966 3:28796416-28796438 CCAGTTTTGGACAAGGTGAATTT No data
Right 952001967 3:28796440-28796462 AATACAGATGTACACTCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952001966 Original CRISPR AAATTCACCTTGTCCAAAAC TGG (reversed) Intergenic
No off target data available for this crispr