ID: 952003175

View in Genome Browser
Species Human (GRCh38)
Location 3:28809834-28809856
Sequence CCAGTGATGAAATGGGAGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952003175_952003180 -10 Left 952003175 3:28809834-28809856 CCAATCTCCCATTTCATCACTGG No data
Right 952003180 3:28809847-28809869 TCATCACTGGGATTCCATTAAGG No data
952003175_952003183 22 Left 952003175 3:28809834-28809856 CCAATCTCCCATTTCATCACTGG No data
Right 952003183 3:28809879-28809901 GGTACCATTTCTCTTTCAGTTGG No data
952003175_952003181 1 Left 952003175 3:28809834-28809856 CCAATCTCCCATTTCATCACTGG No data
Right 952003181 3:28809858-28809880 ATTCCATTAAGGTCATTCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952003175 Original CRISPR CCAGTGATGAAATGGGAGAT TGG (reversed) Intergenic
No off target data available for this crispr