ID: 952013172

View in Genome Browser
Species Human (GRCh38)
Location 3:28925963-28925985
Sequence GAGCAGGTCAATGAAAATAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952013172_952013176 12 Left 952013172 3:28925963-28925985 CCTCTATTTTCATTGACCTGCTC No data
Right 952013176 3:28925998-28926020 TCCTATTTCTGTAGTAGTGTGGG No data
952013172_952013175 11 Left 952013172 3:28925963-28925985 CCTCTATTTTCATTGACCTGCTC No data
Right 952013175 3:28925997-28926019 TTCCTATTTCTGTAGTAGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952013172 Original CRISPR GAGCAGGTCAATGAAAATAG AGG (reversed) Intergenic
No off target data available for this crispr