ID: 952016030

View in Genome Browser
Species Human (GRCh38)
Location 3:28958777-28958799
Sequence GGCTGAAGACTCCACGGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952016026_952016030 -10 Left 952016026 3:28958764-28958786 CCACTGGATCCCAGGCTGAAGAC No data
Right 952016030 3:28958777-28958799 GGCTGAAGACTCCACGGAGCAGG No data
952016023_952016030 7 Left 952016023 3:28958747-28958769 CCTGGGTGCAACTGCAGCCACTG No data
Right 952016030 3:28958777-28958799 GGCTGAAGACTCCACGGAGCAGG No data
952016022_952016030 11 Left 952016022 3:28958743-28958765 CCATCCTGGGTGCAACTGCAGCC No data
Right 952016030 3:28958777-28958799 GGCTGAAGACTCCACGGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952016030 Original CRISPR GGCTGAAGACTCCACGGAGC AGG Intergenic
No off target data available for this crispr