ID: 952018226

View in Genome Browser
Species Human (GRCh38)
Location 3:28985102-28985124
Sequence GTGTGGGATAAATGCTTTAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952018222_952018226 14 Left 952018222 3:28985065-28985087 CCTGAAAAAACTGAGTTTCACAT No data
Right 952018226 3:28985102-28985124 GTGTGGGATAAATGCTTTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952018226 Original CRISPR GTGTGGGATAAATGCTTTAT AGG Intergenic
No off target data available for this crispr