ID: 952023136

View in Genome Browser
Species Human (GRCh38)
Location 3:29047290-29047312
Sequence GTACTCCTGCTTGACTACCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952023130_952023136 27 Left 952023130 3:29047240-29047262 CCTAGTGGAAAGTGTGCTCTTGG No data
Right 952023136 3:29047290-29047312 GTACTCCTGCTTGACTACCCAGG No data
952023134_952023136 4 Left 952023134 3:29047263-29047285 CCAACATTTCCAGAATGGGTACA No data
Right 952023136 3:29047290-29047312 GTACTCCTGCTTGACTACCCAGG No data
952023135_952023136 -5 Left 952023135 3:29047272-29047294 CCAGAATGGGTACAGATAGTACT No data
Right 952023136 3:29047290-29047312 GTACTCCTGCTTGACTACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952023136 Original CRISPR GTACTCCTGCTTGACTACCC AGG Intergenic
No off target data available for this crispr