ID: 952026814

View in Genome Browser
Species Human (GRCh38)
Location 3:29092723-29092745
Sequence GTGCCAAAACAGAATGGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952026814_952026818 12 Left 952026814 3:29092723-29092745 CCAGGCCCATTCTGTTTTGGCAC No data
Right 952026818 3:29092758-29092780 ATCATTTGACTTCCATTTCATGG No data
952026814_952026819 21 Left 952026814 3:29092723-29092745 CCAGGCCCATTCTGTTTTGGCAC No data
Right 952026819 3:29092767-29092789 CTTCCATTTCATGGCAAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952026814 Original CRISPR GTGCCAAAACAGAATGGGCC TGG (reversed) Intergenic
No off target data available for this crispr