ID: 952031999

View in Genome Browser
Species Human (GRCh38)
Location 3:29154216-29154238
Sequence AGGGTGTTATAGGAATTACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952031993_952031999 14 Left 952031993 3:29154179-29154201 CCTTGAGTGTCTCCTTTTCCTCA No data
Right 952031999 3:29154216-29154238 AGGGTGTTATAGGAATTACAAGG No data
952031996_952031999 -4 Left 952031996 3:29154197-29154219 CCTCACTTAATGTGCTGCAAGGG No data
Right 952031999 3:29154216-29154238 AGGGTGTTATAGGAATTACAAGG No data
952031994_952031999 2 Left 952031994 3:29154191-29154213 CCTTTTCCTCACTTAATGTGCTG No data
Right 952031999 3:29154216-29154238 AGGGTGTTATAGGAATTACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952031999 Original CRISPR AGGGTGTTATAGGAATTACA AGG Intergenic
No off target data available for this crispr