ID: 952034296

View in Genome Browser
Species Human (GRCh38)
Location 3:29180773-29180795
Sequence AGGTACAATCAGAAGGGACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952034290_952034296 30 Left 952034290 3:29180720-29180742 CCTAATTTAGGGAGAATACAGAA No data
Right 952034296 3:29180773-29180795 AGGTACAATCAGAAGGGACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952034296 Original CRISPR AGGTACAATCAGAAGGGACA AGG Intergenic
No off target data available for this crispr