ID: 952036549

View in Genome Browser
Species Human (GRCh38)
Location 3:29209321-29209343
Sequence CTGGCTTTCTTCTGAGGCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952036549_952036552 30 Left 952036549 3:29209321-29209343 CCAAAGCCTCAGAAGAAAGCCAG No data
Right 952036552 3:29209374-29209396 ATTATATTTAAATAGACATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952036549 Original CRISPR CTGGCTTTCTTCTGAGGCTT TGG (reversed) Intergenic
No off target data available for this crispr