ID: 952037584

View in Genome Browser
Species Human (GRCh38)
Location 3:29221220-29221242
Sequence GCTCCTGGAAGCTGGCACAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952037576_952037584 -1 Left 952037576 3:29221198-29221220 CCTCCATGCCCAGAACCTCAAGG No data
Right 952037584 3:29221220-29221242 GCTCCTGGAAGCTGGCACAGAGG No data
952037575_952037584 0 Left 952037575 3:29221197-29221219 CCCTCCATGCCCAGAACCTCAAG No data
Right 952037584 3:29221220-29221242 GCTCCTGGAAGCTGGCACAGAGG No data
952037581_952037584 -10 Left 952037581 3:29221207-29221229 CCAGAACCTCAAGGCTCCTGGAA No data
Right 952037584 3:29221220-29221242 GCTCCTGGAAGCTGGCACAGAGG No data
952037574_952037584 11 Left 952037574 3:29221186-29221208 CCGCGGAAGCTCCCTCCATGCCC No data
Right 952037584 3:29221220-29221242 GCTCCTGGAAGCTGGCACAGAGG No data
952037578_952037584 -4 Left 952037578 3:29221201-29221223 CCATGCCCAGAACCTCAAGGCTC No data
Right 952037584 3:29221220-29221242 GCTCCTGGAAGCTGGCACAGAGG No data
952037580_952037584 -9 Left 952037580 3:29221206-29221228 CCCAGAACCTCAAGGCTCCTGGA No data
Right 952037584 3:29221220-29221242 GCTCCTGGAAGCTGGCACAGAGG No data
952037573_952037584 15 Left 952037573 3:29221182-29221204 CCTTCCGCGGAAGCTCCCTCCAT No data
Right 952037584 3:29221220-29221242 GCTCCTGGAAGCTGGCACAGAGG No data
952037570_952037584 30 Left 952037570 3:29221167-29221189 CCCTGTTGTGGCAGTCCTTCCGC No data
Right 952037584 3:29221220-29221242 GCTCCTGGAAGCTGGCACAGAGG No data
952037571_952037584 29 Left 952037571 3:29221168-29221190 CCTGTTGTGGCAGTCCTTCCGCG No data
Right 952037584 3:29221220-29221242 GCTCCTGGAAGCTGGCACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952037584 Original CRISPR GCTCCTGGAAGCTGGCACAG AGG Intergenic