ID: 952038571

View in Genome Browser
Species Human (GRCh38)
Location 3:29234134-29234156
Sequence CATCAGGACTTGGGGGAAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952038564_952038571 -1 Left 952038564 3:29234112-29234134 CCTCATGGATAATGTAACCATTC No data
Right 952038571 3:29234134-29234156 CATCAGGACTTGGGGGAAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952038571 Original CRISPR CATCAGGACTTGGGGGAAGT AGG Intergenic
No off target data available for this crispr