ID: 952038925

View in Genome Browser
Species Human (GRCh38)
Location 3:29238133-29238155
Sequence GACCCAATGATTCTACTCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952038925_952038928 13 Left 952038925 3:29238133-29238155 CCTGTGAGTAGAATCATTGGGTC No data
Right 952038928 3:29238169-29238191 TATATTTTCCAAAAGCTATTTGG No data
952038925_952038930 30 Left 952038925 3:29238133-29238155 CCTGTGAGTAGAATCATTGGGTC No data
Right 952038930 3:29238186-29238208 ATTTGGAATGCTGTTCAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952038925 Original CRISPR GACCCAATGATTCTACTCAC AGG (reversed) Intergenic
No off target data available for this crispr