ID: 952039303

View in Genome Browser
Species Human (GRCh38)
Location 3:29242119-29242141
Sequence CTGATAACTGAGATGAAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952039302_952039303 -4 Left 952039302 3:29242100-29242122 CCAAGAGATATTTATAATACTGA No data
Right 952039303 3:29242119-29242141 CTGATAACTGAGATGAAAAAAGG No data
952039301_952039303 -3 Left 952039301 3:29242099-29242121 CCCAAGAGATATTTATAATACTG No data
Right 952039303 3:29242119-29242141 CTGATAACTGAGATGAAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952039303 Original CRISPR CTGATAACTGAGATGAAAAA AGG Intergenic
No off target data available for this crispr