ID: 952049807

View in Genome Browser
Species Human (GRCh38)
Location 3:29370883-29370905
Sequence CCTACATGGCAGAGGCTAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 174}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952049807 Original CRISPR CCTACATGGCAGAGGCTAGA GGG Intronic
902971544 1:20056039-20056061 CCTAAATTCCAGAGGCTAAAAGG + Intronic
905007458 1:34721333-34721355 GCTGGAAGGCAGAGGCTAGAGGG - Intronic
906613269 1:47218173-47218195 CCTCGAAGGCAGAGCCTAGAGGG + Exonic
907259411 1:53206217-53206239 CCTACATTTCAGAGGCTATATGG + Intronic
910702718 1:90093395-90093417 CCTAGAGGGAATAGGCTAGATGG - Intergenic
911691857 1:100843967-100843989 CCTACAAGCCAGAGGCGAGTGGG - Intergenic
911693750 1:100864066-100864088 TCTAAATGGCAGAGCCTGGATGG - Intergenic
912367328 1:109145179-109145201 CTCACATGGCAGAAGGTAGAAGG - Intronic
912450300 1:109764131-109764153 CCTAAAAGGCAGAGGGAAGAGGG - Intronic
915579911 1:156807376-156807398 CCTAGGAGGCAGAGGGTAGAGGG - Intronic
915595765 1:156895506-156895528 CCTACAGGGGAGAAGCCAGAAGG + Intronic
917050620 1:170918236-170918258 CTCACATGGCAGAAGGTAGAAGG - Intergenic
917864160 1:179177328-179177350 CCTCTTTGGCAGAGGCCAGAAGG - Intronic
918740619 1:188126706-188126728 CTCACATGGCAGAAGGTAGAGGG + Intergenic
922161076 1:223079554-223079576 AGTACATGGCCGAGGCTGGAAGG - Intergenic
1063722689 10:8599986-8600008 CTTACATGACACAGGCAAGAGGG + Intergenic
1064670013 10:17703706-17703728 CCTATTTGGGAGAGGCTGGAAGG - Intronic
1068275822 10:54794667-54794689 CCTACCTGGTAGAGGTTAAATGG + Intronic
1069716743 10:70526011-70526033 CCTACAGGGCAGTGGCACGATGG + Exonic
1069749284 10:70735310-70735332 ACCACCTGGCAGAGGCCAGATGG - Intronic
1069867026 10:71510442-71510464 GCTACATTGGAGAGGCAAGAGGG + Intronic
1076791421 10:132778922-132778944 GCCACATGGCAGAGGCCAGCAGG - Intronic
1078422758 11:11225699-11225721 CCTACATGGCAGAAGGTGGAAGG + Intergenic
1078936221 11:15952652-15952674 CCTACCAGGCAGAGACTGGAAGG + Intergenic
1081324676 11:41729481-41729503 CTTACATGGCAGCAGCAAGAGGG - Intergenic
1081394472 11:42569476-42569498 CCCACATGGCAGAAGGCAGAAGG + Intergenic
1082828242 11:57597170-57597192 CCTACAGGGCACAGGGGAGATGG + Intergenic
1082882921 11:58055856-58055878 CTTACATGGCTGAAGATAGAAGG - Exonic
1084595616 11:70115211-70115233 CCCACCTGGCAGGGGTTAGAAGG + Intronic
1084959571 11:72709483-72709505 CCAAGATGGCAGAGGCTTGGTGG + Intronic
1086285396 11:85243378-85243400 GCTACATGCCAGATGCTATATGG - Intronic
1087238200 11:95744689-95744711 CTCACATGGCAGAAGGTAGAAGG - Intergenic
1087416027 11:97856673-97856695 CATAAATGGCACAGGCTATAAGG + Intergenic
1089244525 11:117109379-117109401 CCTGCATAGCTGAGGCTACAAGG + Intergenic
1092093464 12:5822890-5822912 CTTACATGGCAGTGGCAAGAGGG + Intronic
1093269491 12:17041769-17041791 CTCACATGGCAGAAGGTAGAAGG - Intergenic
1093297043 12:17404015-17404037 CTTACATGGCAGTGGCAAGAGGG - Intergenic
1095934014 12:47657323-47657345 CCTTCATGCCTGAGACTAGATGG + Intergenic
1098592312 12:72228242-72228264 CCTAGATTTCAGAGGCTGGATGG - Intronic
1099058908 12:77880990-77881012 GCTACATTGCCCAGGCTAGAAGG + Intronic
1099318453 12:81114361-81114383 CCTACAGGGCAGGGGTTGGAAGG - Intronic
1099517666 12:83618173-83618195 CCCACATGGCAGAGATTACATGG + Intergenic
1101370982 12:104130068-104130090 CCAACATGGCAGATCCTAGAAGG + Intronic
1106013532 13:25847085-25847107 CCCAGATGGCAGAGGCCACATGG - Intronic
1110159335 13:72357071-72357093 CTCACATGGCAGAGGACAGAAGG + Intergenic
1110372621 13:74756685-74756707 TCTACATGGCAGAAGGCAGAAGG + Intergenic
1110890024 13:80687918-80687940 CTTACATGGCAGGAGCAAGAGGG + Intergenic
1117514315 14:56485398-56485420 CTTACATGGCAGAAGATGGAAGG + Intergenic
1120566836 14:86070323-86070345 CCTCCATGACACAGTCTAGAGGG - Intergenic
1120861070 14:89255527-89255549 CCAGAATGCCAGAGGCTAGATGG + Intronic
1121890322 14:97584128-97584150 CTTACATGGTGGAGGCAAGAGGG + Intergenic
1122355741 14:101121958-101121980 CCGTCCTGGCAGAGGCCAGAAGG - Intergenic
1202904333 14_GL000194v1_random:59780-59802 GCTGCCTGGCAGAGGCTGGATGG + Intergenic
1125103662 15:35945671-35945693 CCTACATTGGAGAGCCTTGATGG + Intergenic
1126804519 15:52333008-52333030 CTTACATGGCAGAAGGTGGAAGG - Intronic
1127103815 15:55592321-55592343 CTTACAAGGCAGAAGCTAGAAGG + Intergenic
1127229976 15:56980390-56980412 CTTACACGGCAGAGGACAGAAGG - Intronic
1127492084 15:59474407-59474429 CTTACATGGCAGAAGGTGGAAGG + Intronic
1127505240 15:59591662-59591684 CCAAAAAAGCAGAGGCTAGAAGG - Intergenic
1127525639 15:59790108-59790130 CTTACATGGCAGCAGCAAGAGGG - Intergenic
1130746244 15:86656997-86657019 CCAACATGGCTGAGGCAAGATGG - Intronic
1131672029 15:94630390-94630412 ACTACATGCCAGAGGCTTGGAGG - Intergenic
1132661397 16:1063054-1063076 CCCACATGGCAGAGGCTGGCGGG - Intergenic
1133111350 16:3549951-3549973 CTGACCTGGCAGAGGCTAGAAGG - Intronic
1133292141 16:4729275-4729297 CCTCCATGGCAGAAGCTAGAGGG + Intronic
1134045053 16:11094715-11094737 ACTACACGGCAGAGGCAGGAGGG - Intronic
1135576237 16:23587952-23587974 CTAACATGGCACAGGCCAGAAGG - Intronic
1137031491 16:35528306-35528328 CCTGCATGGCAGTGGTGAGAAGG + Intergenic
1137384233 16:48026801-48026823 CTTACATGGCAGAAGGCAGAAGG + Intergenic
1139022814 16:62772864-62772886 CTCACATGGCAGAAGGTAGAAGG + Intergenic
1139180917 16:64747621-64747643 CTTACATGACAGCAGCTAGATGG + Intergenic
1140795060 16:78429608-78429630 CCTACATGGCATAGACAACAGGG - Intronic
1142957076 17:3529563-3529585 CCTTCCTGGAGGAGGCTAGAGGG - Intronic
1146567231 17:33923915-33923937 ACTACATGGCAGAAGATACAGGG + Intronic
1148861486 17:50606666-50606688 CCTACCTGGCGGAGGGCAGAGGG + Intronic
1151052999 17:71000537-71000559 CCTACATGCCAGAAGCTATCTGG + Intergenic
1151294100 17:73171106-73171128 CCCCAAGGGCAGAGGCTAGAAGG - Intergenic
1152020536 17:77777990-77778012 CCTAACTGGCAGAGACCAGAGGG + Intergenic
1152523980 17:80876879-80876901 CCTGCATGGCACAGGCTCGGTGG - Intronic
1157689172 18:49667040-49667062 CCCATGTTGCAGAGGCTAGAAGG + Intergenic
1158383447 18:56961590-56961612 TCTACATGGCTGAGGCCTGAAGG - Intronic
1159654811 18:71020264-71020286 GATACATGGCAGAGGCGAGAGGG - Intergenic
1159975630 18:74708426-74708448 GCTACATAGCAGAGGATACAAGG - Intronic
1163849876 19:19656766-19656788 CCTGCAGGGCAGAGGCAGGAGGG + Exonic
1168079516 19:53999227-53999249 CCTACATGGAAGATTCTAGTAGG - Intronic
1168134520 19:54341513-54341535 TCTCCATGGCAGAGGCTGGAGGG + Intergenic
1168703973 19:58457663-58457685 CCTGCATGGCAGAGACAAAAGGG + Exonic
926223328 2:10950395-10950417 CCTACATGGCAGGAGAAAGAGGG - Intergenic
926375537 2:12223879-12223901 CCTACATTTCAGAGGATATATGG + Intergenic
926410117 2:12594371-12594393 CCTCTATGGCCGGGGCTAGAAGG + Intergenic
926628604 2:15117125-15117147 CATACCTGGCAGAGGAAAGAGGG + Intergenic
926646397 2:15294335-15294357 CCTATATGGCTAAGGCTTGAGGG + Intronic
927305722 2:21570383-21570405 TCTCCATGTCAAAGGCTAGATGG + Intergenic
930239650 2:48922876-48922898 CTCACATGGCAGAAGCTGGAAGG + Intergenic
935523798 2:104141887-104141909 CCTCCATGTCGAAGGCTAGAAGG - Intergenic
936018480 2:108977148-108977170 CCTAGATGGCTAAGGCTAAAGGG + Intronic
940298869 2:152158783-152158805 CTTACATGGCAGAAGGTAGAAGG + Intronic
940478723 2:154200629-154200651 CTCACATGGCAGAAGGTAGAAGG + Intronic
942770420 2:179511320-179511342 TCTAAATGGCAGATGGTAGATGG + Intronic
943670797 2:190658297-190658319 CGCACATGGCACAGGGTAGAAGG - Intronic
947052729 2:226064674-226064696 CTTACATGGCAGGAGCAAGACGG - Intergenic
947665644 2:231903887-231903909 CTCACATGGCAGAAGCTGGAAGG + Intergenic
948092536 2:235306602-235306624 CTTACATGGCGGTGGCAAGAGGG + Intergenic
948899672 2:240949927-240949949 CCCTCATGGAAGAGGCTGGAAGG + Intronic
1168930960 20:1623531-1623553 CCTAGATGTCAGAGGATATATGG - Intergenic
1168975056 20:1958598-1958620 CTTATATGGCAGAGGGCAGAAGG - Intergenic
1169624745 20:7552669-7552691 CCCACATGGCAGAAGATGGAAGG + Intergenic
1170137886 20:13095193-13095215 CCTACTTGGCAAAGGATAAAGGG + Intronic
1172270824 20:33654872-33654894 CAGACAAGGCAGAGGCTTGAGGG + Intergenic
1176512301 21:7758097-7758119 TTTACATGGCAGAATCTAGAAGG - Intronic
1176703124 21:10082573-10082595 CCTACACTGCAGAGGGTAGAGGG + Intergenic
1178646413 21:34388621-34388643 TTTACATGGCAGAATCTAGAAGG - Exonic
1179344591 21:40545128-40545150 CCTACATGGCACAGAGCAGAAGG - Intronic
1179553266 21:42156708-42156730 CCAACTTGGCAGGGACTAGAGGG + Intergenic
1179562985 21:42228477-42228499 CCTACAATTCAGAGTCTAGATGG + Intronic
1179725563 21:43339695-43339717 CTTACATGGCAGAGGGTAGCTGG + Intergenic
1184559784 22:45255549-45255571 CTCACATGGCAGAAGGTAGAAGG + Intergenic
952049807 3:29370883-29370905 CCTACATGGCAGAGGCTAGAGGG + Intronic
953152776 3:40340293-40340315 CCCACATGGCAGAAGCGATATGG - Intergenic
953842295 3:46398644-46398666 CCTACATTACAGAGGGTAGAAGG - Intergenic
954973028 3:54667378-54667400 CCTCCAAGGCAGAGGCTGGAAGG + Intronic
956164262 3:66384532-66384554 TCTACATGGCAGTGCCTATACGG + Intronic
958635113 3:96733938-96733960 CCAAAATAGCAGAGGGTAGATGG - Intergenic
959626861 3:108462488-108462510 ACGACATGGCAAAGGCTAGGTGG + Intronic
960891642 3:122454507-122454529 CATACATGGTACAGGCTAAAAGG - Intronic
962342513 3:134597212-134597234 CCTGGATGGCAGGGGCAAGAGGG + Intergenic
962847642 3:139285920-139285942 CCACCATGGCAGAGGCTAATGGG + Intronic
964037920 3:152220959-152220981 CATACATGAAAGAGGCCAGACGG - Intergenic
964810598 3:160659717-160659739 ACTTCATGGCAGAAGGTAGAAGG - Intergenic
965809995 3:172581572-172581594 AATACATGCCAGGGGCTAGAGGG - Intergenic
967622552 3:191650901-191650923 CCTACATGTCAGAGGATGTATGG - Intergenic
968036820 3:195554594-195554616 CCTTCATGGCAGCGGCTCCACGG - Intergenic
975740897 4:77427837-77427859 CTCACATGGCAGAAGGTAGAGGG + Intronic
976930753 4:90563944-90563966 CCAAAATGGCAAAGGCTAAAAGG - Intronic
976983690 4:91265955-91265977 CTTACATGGCAGCAGCAAGAGGG + Intronic
979264132 4:118682115-118682137 TCTACATGGTAGAGGGTAGAAGG + Intergenic
980375326 4:131938940-131938962 CCTACACTGCAGAGGGTAGAGGG + Intergenic
982331361 4:154185192-154185214 CCTACATGGCAGAAGGCAGAGGG - Intergenic
983267729 4:165524794-165524816 CCTACAGGGCAAAGACAAGAAGG - Intergenic
986686627 5:10280486-10280508 CCTACATTGACGAGGCCAGAAGG - Exonic
988217691 5:28296637-28296659 CAGAAATGGCAGAGGCTTGAAGG - Intergenic
992138230 5:73768988-73769010 CTTACATGGCAGCGGCAAGAGGG - Intronic
992187346 5:74257165-74257187 CTTACATGGCAGAGGTTAAATGG - Intergenic
992212865 5:74497477-74497499 CTTACATGGCAGAAGGAAGAGGG - Intergenic
992985572 5:82225521-82225543 CCTACAAAGCAGCAGCTAGATGG - Intronic
994386833 5:99142827-99142849 CTTACATGGCAGTGGCAAGAGGG - Intergenic
994796539 5:104307841-104307863 CCTTCAGGGCAGAGGCTTGGCGG - Intergenic
995510842 5:112907530-112907552 ACTACAAGGCAGAGGATAGTTGG + Intronic
999757614 5:154676770-154676792 GCTACAAGTCAGAGGATAGATGG - Intergenic
1000023267 5:157337358-157337380 CCAACATGGCAGCGGTCAGACGG + Intronic
1000249738 5:159482614-159482636 ACCACATGGCAGAGGGTAAAGGG + Intergenic
1000527688 5:162379068-162379090 CTTACCTGGCAGAGAGTAGAAGG + Intergenic
1001896978 5:175390902-175390924 CCTACATTACAGAGGCTAATTGG + Intergenic
1002921714 6:1577554-1577576 CCTACCTGGCCCAGGCTGGAAGG + Intergenic
1003326621 6:5096805-5096827 CCAAACTGGCAGAGGCCAGAGGG - Intergenic
1006698095 6:35948913-35948935 CCCACATGGCAGAAGGTGGAAGG - Intronic
1008586737 6:52957518-52957540 CTTTCATGGCAGGGGCAAGATGG - Intergenic
1012443618 6:99286162-99286184 CCTGCATGACAGATGCTAAAAGG - Intronic
1014633342 6:123814138-123814160 CCTACAAGGCAGGGGGTGGAGGG + Intronic
1015288363 6:131509987-131510009 CCTAAATGGTAGAGGCAAAATGG + Intergenic
1016029403 6:139322312-139322334 CTCACATGGCAGAAGGTAGAAGG + Intergenic
1017134264 6:151134435-151134457 ACTGCATGGAAGGGGCTAGAGGG + Intergenic
1017286850 6:152685843-152685865 TCAACATGGCAGAAGGTAGAAGG - Intergenic
1021976935 7:26020216-26020238 CTCACATGGCAGAAGGTAGAAGG - Intergenic
1023977019 7:45038020-45038042 CCTCCATGCCAGAGGCTGCATGG + Intronic
1025652500 7:63483657-63483679 GCTACATGTCGGAGGCTGGAAGG - Intergenic
1027300404 7:76827922-76827944 CCTAGATTTCAGAGGCTATATGG - Intergenic
1033616313 7:143017913-143017935 CCTAGATGGTACAGGCTAGATGG + Intergenic
1034964556 7:155383152-155383174 CCTGCAGGGTAGAGGCTGGAGGG - Intronic
1036687554 8:10922018-10922040 CTTACATGGCAGAGGGCAGAAGG - Intronic
1037393234 8:18416427-18416449 CCCAGAGGGCAGAGGCTAGGGGG - Intergenic
1037740645 8:21606335-21606357 CTTACATGGCAGAAGGCAGAAGG - Intergenic
1039170235 8:34736884-34736906 CCTACATGGGTGGGGCTGGAAGG - Intergenic
1040581485 8:48702160-48702182 ACTTCTTGGCAGAGGCTGGAAGG + Intergenic
1040956563 8:52985807-52985829 TCAGCATGGCAGAGGCTTGATGG - Intergenic
1041403663 8:57472474-57472496 CTCACATGGCAGAGGGTGGAAGG + Intergenic
1041815171 8:61962299-61962321 CTTACATGGCAGAAGGTGGAAGG + Intergenic
1042184443 8:66122725-66122747 TCTAAAAGGAAGAGGCTAGAAGG - Intergenic
1043549982 8:81360344-81360366 TACACATGTCAGAGGCTAGAAGG + Intergenic
1044831391 8:96253402-96253424 CCTACAGGACAGAAGGTAGAAGG - Intronic
1045484620 8:102621499-102621521 ACTACATGGGAGAGCCCAGAGGG + Intergenic
1046414517 8:113894682-113894704 CCTACATGGCAGATGATAACAGG - Intergenic
1048806546 8:138246557-138246579 CCTAGATTTCAGAGGCTATATGG + Intronic
1048841966 8:138574539-138574561 CCCACATGGCAGAAAGTAGAAGG + Intergenic
1049276747 8:141723775-141723797 CCTACATGGCAGAGCGGGGAAGG - Intergenic
1052324415 9:27202061-27202083 TCTAAAGGGCACAGGCTAGAAGG - Intronic
1053182557 9:35986200-35986222 CCTGCATACCAGAGGTTAGATGG - Intergenic
1053640383 9:40069606-40069628 CCTACACTGCAGAGGGTAGAGGG + Intergenic
1053765752 9:41395867-41395889 CCTACACTGCAGAGGGTAGAGGG - Intergenic
1054321078 9:63665602-63665624 CCTACACTGCAGAGGGTAGAGGG + Intergenic
1054544365 9:66307020-66307042 CCTACACTGCAGAGGGTAGAGGG - Intergenic
1058420588 9:104829260-104829282 CGTACATTTCAGAGTCTAGAGGG - Intronic
1060748600 9:126154200-126154222 ACAACATGACTGAGGCTAGAAGG + Intergenic
1062542200 9:137046420-137046442 CCTACCGGGAAGAGGCCAGAAGG - Intergenic
1202788153 9_KI270719v1_random:52679-52701 CCTACACTGCAGAGGGTAGAGGG + Intergenic
1203563219 Un_KI270744v1:74505-74527 GCTGCCTGGCAGAGGCTGGATGG - Intergenic
1187316710 X:18202515-18202537 CTCACATGGCAGAAGGTAGAAGG - Intronic
1188448829 X:30287128-30287150 GCTAAATGGCAGAAGCTAAAGGG - Intergenic
1189201226 X:39197253-39197275 CCTTCATGGCAGAGGCTGGATGG + Intergenic
1192233017 X:69278699-69278721 CCCACTTGGCAGAGGCGAGCCGG + Intergenic
1194321270 X:92448535-92448557 TCTACATGGCAGGGGGTGGAGGG - Intronic
1195265920 X:103179643-103179665 CTTACATGGCAGAAGGTGGAAGG + Intergenic
1196813068 X:119643855-119643877 GCTACATGGCATCTGCTAGAAGG + Intronic
1199654628 X:149982044-149982066 TCTGCATGGAAGAGGCTGGAAGG - Intergenic
1199822195 X:151460762-151460784 CCTAGAGGGGAGAGGATAGAGGG - Intergenic
1200629387 Y:5561682-5561704 TCTACATGGCAGGGGGTGGAGGG - Intronic