ID: 952052485

View in Genome Browser
Species Human (GRCh38)
Location 3:29401492-29401514
Sequence CTGTAGCCCTGCACCAGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 194}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952052485_952052490 22 Left 952052485 3:29401492-29401514 CCTTCACTGGTGCAGGGCTACAG 0: 1
1: 0
2: 0
3: 13
4: 194
Right 952052490 3:29401537-29401559 CTACTGCTTTCTTAAACTTAGGG 0: 1
1: 0
2: 0
3: 24
4: 185
952052485_952052489 21 Left 952052485 3:29401492-29401514 CCTTCACTGGTGCAGGGCTACAG 0: 1
1: 0
2: 0
3: 13
4: 194
Right 952052489 3:29401536-29401558 ACTACTGCTTTCTTAAACTTAGG 0: 1
1: 0
2: 0
3: 23
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952052485 Original CRISPR CTGTAGCCCTGCACCAGTGA AGG (reversed) Intronic
900419081 1:2547842-2547864 CTGAGGCCCTGCAGCAGTGGGGG + Intergenic
900908409 1:5576935-5576957 GTGTAGCCCTGTACAGGTGAGGG + Intergenic
901616165 1:10541454-10541476 CCGTAGCCCTGCCCTAGTGTGGG + Intronic
904369745 1:30040809-30040831 CTGTAGCCTTGCTCATGTGATGG - Intergenic
904896008 1:33819091-33819113 CTGTAGCCCTGCCCCAAAGCAGG + Intronic
905930604 1:41784162-41784184 CTGTAGCCCTGCTCTAGGGCAGG - Intronic
907278247 1:53328546-53328568 CTGGACCCCTGCACCTGTCATGG + Intergenic
912384483 1:109264407-109264429 CTGCAGCCCCGCTCCACTGAGGG + Intronic
917616889 1:176755053-176755075 CTGGAGCCTTGCAACACTGATGG - Intronic
917721811 1:177792815-177792837 CCGTGGCCCTCCACCAGTGGAGG - Intergenic
918318701 1:183344951-183344973 CTGTGGCTCTGAACTAGTGAAGG - Intronic
919822624 1:201482532-201482554 CTATTGCTCTGCACCATTGATGG + Intergenic
920099294 1:203507067-203507089 CTGTCCCTCTGCACCAGGGAGGG + Intronic
921171457 1:212553447-212553469 CTGAACCCCAGCACCATTGAAGG - Intergenic
921482123 1:215675495-215675517 CTGGAGGCCTGCACCAGAGCAGG - Exonic
922882449 1:228991006-228991028 CCAGAGCCCTTCACCAGTGACGG + Intergenic
923923002 1:238590046-238590068 CTTTACCCCTACACCAGTAAGGG + Intergenic
924196989 1:241618511-241618533 TTGTGCTCCTGCACCAGTGATGG - Intronic
924653097 1:245948522-245948544 CTGTGGCACTGCTCCAGGGAGGG + Intronic
1063050418 10:2441181-2441203 CAATAGCCCTGTACCTGTGATGG - Intergenic
1063076632 10:2723302-2723324 CTGCACGCCTGCCCCAGTGAAGG + Intergenic
1064617381 10:17174634-17174656 CTGTATACCTGCACAAGTGGTGG - Exonic
1066262011 10:33738303-33738325 CTGCAGCCCTCCCCCAGAGATGG + Intergenic
1067438590 10:46295550-46295572 CTTTAACCCTGAACCAGGGATGG - Intronic
1069572172 10:69500890-69500912 CAGCATCCCTGCACCAGGGAGGG + Intronic
1069769866 10:70891370-70891392 CAGCTGCCCTCCACCAGTGAGGG + Intergenic
1072012510 10:91315180-91315202 CTGTAGGCCTGCAGAAGAGATGG + Intergenic
1074446417 10:113524827-113524849 CTGTAGCCCTGTGCCAGGGCTGG + Intergenic
1075027528 10:118996856-118996878 CTGTAGCCAGCTACCAGTGAGGG - Intergenic
1075718276 10:124569625-124569647 CTGTGGCCCTGAACCAGGGCTGG + Intronic
1077019984 11:413081-413103 CTGTGTCCCTGCAGCAGGGAGGG - Intronic
1083611386 11:64006002-64006024 CTGTAGCCCTCCTCCAGAGAGGG - Intronic
1083924976 11:65800588-65800610 CTCTTCCCCTGCACCACTGATGG - Intergenic
1083951232 11:65957619-65957641 CTGTGGCCCTGTGCCAGGGAAGG - Intronic
1084793552 11:71489945-71489967 CTGGAGGCCTGCACCAGCGTTGG + Intronic
1086783071 11:90931104-90931126 CAGCTGCCCTCCACCAGTGAGGG - Intergenic
1087167979 11:95023417-95023439 CTGTAGCCCAGGAATAGTGAAGG + Intergenic
1087672982 11:101128443-101128465 CTGGGGCCCCGGACCAGTGAGGG + Exonic
1089632284 11:119791348-119791370 CAGCCGTCCTGCACCAGTGAGGG - Intergenic
1091757163 12:3061513-3061535 CTGTAGCCCTCCTACAGTGGTGG + Intergenic
1091989905 12:4946877-4946899 ATTTAACCCTGCACTAGTGATGG - Intergenic
1093385851 12:18552180-18552202 CAGAATCCCTGCACCACTGAGGG + Intronic
1093616697 12:21233858-21233880 CAGTAGCCCTGCTCTGGTGATGG - Intronic
1095998925 12:48113053-48113075 CTGTAGCCCAGGAACAGTCAGGG + Intronic
1096826625 12:54283526-54283548 CTGTGGCCCTGGATCCGTGAAGG + Intronic
1098034097 12:66284421-66284443 CTGCAGCCCTGGACCAGATAGGG + Intergenic
1101584320 12:106071271-106071293 CAGAGGCCCTGCCCCAGTGACGG + Intronic
1104000681 12:124857920-124857942 CTGCAGCCCAGCAGTAGTGAGGG + Intronic
1104035491 12:125094515-125094537 CTGTGGCTCTGCAGCAGAGAGGG - Intronic
1104984902 12:132591303-132591325 CTGAGGCCCTGCACCAGGCAGGG - Intergenic
1105865978 13:24460302-24460324 CTGGAGCCATTCACCAGTGGTGG + Intronic
1110663569 13:78088526-78088548 CTCTAGCCCTTCACCGGAGATGG + Intergenic
1112547140 13:100382049-100382071 CTGCTGCCCTCCACCAGCGAGGG + Intronic
1114556540 14:23565564-23565586 CTGTATCCCTGGATCAGAGAGGG - Intronic
1119230389 14:72974818-72974840 CTGGGGCCCTGCGCCAGTGCGGG - Exonic
1121545655 14:94761566-94761588 CTGGGCCCCTGCACCAGTGGAGG + Intergenic
1122976364 14:105172491-105172513 CTCTAGCCCAGCCCCAGTCAGGG + Intergenic
1123931784 15:25175460-25175482 CTGAAGCCCTGCAGGGGTGACGG + Intergenic
1123933461 15:25182925-25182947 CTGAAGCCCTGCAGGGGTGACGG + Intergenic
1123935885 15:25193872-25193894 CTGAAGCCCTGCAGGGGTGACGG + Intergenic
1123938117 15:25203777-25203799 CTGAAGCCCTGCAGGGGTGATGG + Intergenic
1123940467 15:25214194-25214216 CTGAAGCCCTGCAAGGGTGATGG + Intergenic
1123945426 15:25236629-25236651 CTGAAGCCCTGCAGGGGTGATGG + Intergenic
1123946269 15:25240388-25240410 CTGAAGCCCTGCAGGGGTGATGG + Intergenic
1123946699 15:25242293-25242315 CTGAAGCCCTGCAAGGGTGATGG + Intergenic
1123947530 15:25246022-25246044 CTGAAGCCCTGCAGGGGTGACGG + Intergenic
1123948346 15:25249738-25249760 CTGAAGCCCTGCAAAGGTGATGG + Intergenic
1125893347 15:43282054-43282076 CTGTGGCCCTGCCTCTGTGAAGG - Exonic
1127394956 15:58537241-58537263 CTGTGGTGCTGCACCAGAGACGG - Intronic
1128199590 15:65792888-65792910 CTGTGGCTCTCCACCATTGATGG + Intronic
1129389115 15:75211745-75211767 CTGCATCCCTGCACCAGTAGCGG - Exonic
1130632188 15:85580617-85580639 CTGAAGCTCTGCAGCAGTGGAGG - Exonic
1132728290 16:1348266-1348288 CTGTCACCCTGCACCTGTGCCGG + Exonic
1134626994 16:15729331-15729353 CTGTTTCCCTGCACCTGAGATGG + Intronic
1138196099 16:55053296-55053318 CTGTAGGCCTGCAGCAACGAGGG + Intergenic
1142340840 16:89521367-89521389 GTGTAGCCCTTCTCCAGTGAGGG - Intronic
1143038943 17:4018124-4018146 CTGTATCCATGCATAAGTGAAGG - Intronic
1143100953 17:4504449-4504471 CTGGGGCCCTGGACCGGTGATGG + Intronic
1143857187 17:9860668-9860690 TTGAAGCCCTACCCCAGTGATGG - Intronic
1144119920 17:12142331-12142353 CTGAAGACCTGGACCAGTGATGG - Exonic
1149169533 17:53792703-53792725 CTATATCCCTCCACCAGTGCTGG + Intergenic
1151885012 17:76918340-76918362 CTGTAGCCCTGAACCCTCGAGGG + Intronic
1156037284 18:32779173-32779195 CTTTAGCCATGCACCAATGGTGG + Intergenic
1160548688 18:79679579-79679601 CTGTCGCCCAGTCCCAGTGACGG - Intergenic
1161122126 19:2534502-2534524 CTGGAGCCATGCATCAGAGAAGG - Intronic
1161221072 19:3118530-3118552 CTGTGTCCCTGGCCCAGTGAGGG + Intronic
1161641435 19:5425979-5426001 AAGCAGCCCTTCACCAGTGATGG + Intergenic
1161888906 19:7019468-7019490 CTGCAGCCCTGCAGCAGCCAAGG - Intergenic
1161890462 19:7032553-7032575 CTGCAGCCCTGCAGCAGCCAAGG + Exonic
1161890986 19:7038180-7038202 CTGCAGCCCTGCAGCAGCCAAGG - Exonic
1161892548 19:7051281-7051303 CTGCAGCCCTGCAGCAGCCAAGG + Exonic
1161893071 19:7056641-7056663 CTGCAGCCCTGCAGCAGCCAAGG - Exonic
1163209750 19:15831600-15831622 CTGTAGCCCAGCAATAGTCAGGG - Intergenic
1163255672 19:16154358-16154380 CTGTAGCTCAGCACTAGGGAGGG - Intronic
1164655063 19:29914944-29914966 CTCTAGCCCTGTACCAACGAGGG - Intergenic
1166904965 19:46101612-46101634 CTGTTGCCCTTCCCCAGTGGGGG + Intergenic
928987022 2:37191764-37191786 CGGCTGCCCTACACCAGTGAAGG - Intronic
931462980 2:62464165-62464187 CAGCTGCCCTCCACCAGTGAGGG - Intergenic
935855520 2:107268941-107268963 CTGTAGAACTGCACCAGGAAAGG + Intergenic
936105355 2:109619272-109619294 CTGTAGTTTGGCACCAGTGATGG + Intergenic
937281383 2:120719690-120719712 CTGTATCCCAGCACCAGGGTGGG - Intergenic
943986961 2:194635319-194635341 CTGTAACCCAGTCCCAGTGAAGG - Intergenic
944511841 2:200473058-200473080 CTGGCACCCTGCACCAGTGTCGG - Intronic
948347755 2:237313326-237313348 CTGTAGCCCTGGGCAAGGGAAGG - Intergenic
949052618 2:241905234-241905256 GTGGTGCCCAGCACCAGTGACGG - Intergenic
1170664246 20:18372709-18372731 CTGAAGCTCTGCACCAGGGTTGG + Intergenic
1175220856 20:57415534-57415556 CTGGCTCCCTGCTCCAGTGATGG + Intergenic
1176172198 20:63701061-63701083 TGGGAGCCCTGCATCAGTGATGG + Intronic
1177388978 21:20442579-20442601 CAGTAGGCCTGCACCTATGAAGG - Intergenic
1178144365 21:29721430-29721452 CTATAGCCCTGCACCACTGTGGG - Intronic
1180990695 22:19934019-19934041 ATGCAGCACTGCACCAGTGAGGG + Intronic
1181459166 22:23076117-23076139 CTGTGGCCCTGCTCCAGACAGGG + Intronic
1182030745 22:27157497-27157519 CTGGTGCCAGGCACCAGTGAAGG + Intergenic
1184500792 22:44870399-44870421 CTGGAGCCCTGAAGCAGTGAGGG - Intergenic
1185147086 22:49143848-49143870 CTGCAGCTCTCCACCTGTGATGG + Intergenic
1185272212 22:49934826-49934848 CGGCTGCTCTGCACCAGTGAGGG + Intergenic
949263497 3:2130275-2130297 CTGGAGCTCTGAACCATTGAGGG + Intronic
949836313 3:8274172-8274194 CTGCAGCCCTGCACCCATGCTGG - Intergenic
952052485 3:29401492-29401514 CTGTAGCCCTGCACCAGTGAAGG - Intronic
953995397 3:47515332-47515354 CTGAAGCTCTGCACCTGGGATGG + Intergenic
955710967 3:61778704-61778726 CTGTAGCCTTGAAGGAGTGAAGG + Intronic
957598896 3:82306285-82306307 CTGTAGTCCTGCACAACTGCAGG + Intergenic
960824245 3:121766844-121766866 CTGTAGCAGTGCACCGGTGATGG + Intergenic
961494090 3:127278169-127278191 TTGTAGTCTTGCACCACTGATGG - Intergenic
961675764 3:128565397-128565419 CTGGAGACCTGCACCAGTCCTGG - Intergenic
961814988 3:129544772-129544794 CTGTAGCACTGCAGCTGGGAGGG + Intronic
962381182 3:134899247-134899269 CTGAAGCCCTGCAGCTGAGAAGG - Intronic
963111746 3:141694214-141694236 CTGTAGCCCAGGAATAGTGAGGG + Intergenic
963425312 3:145115776-145115798 CTGTAGCCCAGGACTAGTCAGGG - Intergenic
963518433 3:146336343-146336365 CTGTAGCCCTGCACAAATATGGG - Intergenic
965016734 3:163167936-163167958 CTCTGGCCCAGCACCAGTCAAGG + Intergenic
965861887 3:173158878-173158900 CTGTAGCCCAGGACTAGTCAGGG + Intergenic
969330416 4:6471233-6471255 CTGGAGCCCTGCCCGAGTGCGGG - Intronic
970870852 4:20815352-20815374 CTGAACCCCTGCACCACTGAGGG + Intronic
973022419 4:45220234-45220256 CAGCTGCCCTCCACCAGTGAGGG + Intergenic
973294620 4:48503383-48503405 CTGTGGCTCAGCACCAGTTATGG - Intronic
976883576 4:89960318-89960340 CAGTTGCTCTCCACCAGTGAGGG + Intergenic
979872761 4:125845940-125845962 CTGCTGCCCTTCACCAGTGCAGG + Intergenic
981964195 4:150581334-150581356 CTGTATATGTGCACCAGTGAGGG - Intronic
985348038 4:189027707-189027729 CTGTAGTCCTGCATCAGCCAGGG - Intergenic
985401293 4:189596841-189596863 CAGAAGCACTGCACCAGTGGAGG + Intergenic
986688984 5:10298154-10298176 CTGCAGCCGTGCCCCATTGATGG - Intronic
987373020 5:17210350-17210372 CTGGAGACCTGCACCAGGGGTGG + Intronic
988077269 5:26368291-26368313 CAATAGCCCTGCTCCAGAGAGGG - Intergenic
994627016 5:102232654-102232676 CAGTTGCTCTCCACCAGTGAGGG + Intergenic
997834317 5:137179936-137179958 CTGTTGCCTGGCATCAGTGAGGG - Intronic
1001054312 5:168436482-168436504 CTGGAGCCCTGCACTTGGGATGG - Intronic
1001319563 5:170669073-170669095 CTGTAGGCCTGCCCCACTGATGG + Intronic
1001744589 5:174082515-174082537 CTGCAGACCTGCAACAGGGAGGG - Intronic
1002400439 5:178988900-178988922 CTGCCCCCCTGCAGCAGTGAAGG - Intronic
1003644090 6:7900347-7900369 CTGTATCCCTCCAGCAGTCACGG + Intronic
1008894830 6:56540984-56541006 ATGTAGCCCTCCAGCAGAGAGGG - Intronic
1011493544 6:87916683-87916705 CAGTTGCTCTCCACCAGTGAGGG - Intergenic
1012190819 6:96277421-96277443 ATGTAACCCTGAAGCAGTGATGG + Intergenic
1016206460 6:141473309-141473331 TGGTTGCCCTCCACCAGTGAGGG + Intergenic
1016449511 6:144166975-144166997 CTGTGGCCCTGCATCTCTGAGGG + Intronic
1017047000 6:150356262-150356284 CAGCTGCCCTCCACCAGTGAGGG + Intergenic
1017068075 6:150548496-150548518 CGGTGGCCATGCACCAGGGAAGG - Intergenic
1017741077 6:157407263-157407285 CTGTAGCCCCGCCCCTGGGAAGG + Intronic
1018898496 6:168038152-168038174 CTCTAGCACTTCTCCAGTGATGG - Intronic
1019100134 6:169623501-169623523 CTGTGGCCCTCAGCCAGTGACGG + Intronic
1019598908 7:1871781-1871803 CTGAACTCCTGCACCTGTGATGG + Intronic
1020909711 7:14113333-14113355 ATGTAGCCCTGCTTCACTGAAGG - Intergenic
1023861523 7:44220059-44220081 CTGTGGCCCCGCTGCAGTGAAGG - Exonic
1023899170 7:44461829-44461851 CTGTGGCCCTGCACCCATGAAGG - Intronic
1024049236 7:45608466-45608488 CAGTAGCCCTGCTCCACTGCTGG - Intronic
1024096982 7:45989833-45989855 ATGAAGCCCAGCACGAGTGAAGG + Intergenic
1026491275 7:70866114-70866136 CTGTAGGACTGCAGAAGTGATGG + Intergenic
1027263371 7:76480528-76480550 GTGTACACCTGCACCAGGGAAGG - Exonic
1027314749 7:76978635-76978657 GTGTACACCTGCACCAGGGAAGG - Intergenic
1027906077 7:84184394-84184416 CTGTAGCTCTGGGCCAGTGCGGG + Intronic
1028038802 7:86020596-86020618 CTGGAGCCCTCCACCATTAAAGG + Intergenic
1029409706 7:100401048-100401070 CTGCAGCACAGCAACAGTGATGG - Exonic
1031355097 7:120780062-120780084 CTGTAGCCCTGGAATAGTCAGGG + Intergenic
1031992908 7:128209506-128209528 CTGTGGCTCTGCAGCAGTAAAGG - Intergenic
1033211611 7:139464080-139464102 CTGTAGCCCAGGAACAGTCAGGG - Intronic
1035551276 8:528732-528754 ATGTACCCCTGTACCAGTCAGGG + Intronic
1039899771 8:41743140-41743162 CTGCAGCCCTGCAGCAGAGTAGG + Intronic
1045251169 8:100484507-100484529 CTTAAGCCCTGGAACAGTGAGGG + Intergenic
1046284201 8:112073966-112073988 CTGTGGCCCTGCTCCTATGAAGG - Intergenic
1046285841 8:112092209-112092231 CTGTTGCCCTACACCAGTCAGGG - Intergenic
1047377562 8:124316558-124316580 CTGTTGCCATAAACCAGTGAGGG + Intronic
1048387028 8:133921627-133921649 CTGTTGCCCTCCACCTGGGATGG + Intergenic
1049232554 8:141492105-141492127 CTGTTGCCCTGCTCCGGTGGGGG - Intergenic
1049361330 8:142213743-142213765 CTGTGGGCCTGGGCCAGTGAGGG + Intronic
1049488367 8:142878236-142878258 CTGTAGGCCAGCCTCAGTGAAGG + Intronic
1054840118 9:69729459-69729481 CTGTAGCCCTTCAATAATGAGGG - Intronic
1056555827 9:87686388-87686410 CTGCTGCCCTGCACGTGTGAGGG + Intronic
1056650998 9:88462312-88462334 CTCTACCCCTGTACCAGTGGTGG - Intronic
1056667263 9:88590641-88590663 CAGCTGCCCTCCACCAGTGAGGG - Intergenic
1056708519 9:88971548-88971570 CTGGAGCTCTGCGCCAGGGACGG - Intergenic
1056762636 9:89426008-89426030 CTGTAGTCCTGAACCAGTTCAGG - Intronic
1057294103 9:93825478-93825500 CTGCAGCCCTGAGCCAGGGAAGG - Intergenic
1057553929 9:96072548-96072570 GAGCAGCCCAGCACCAGTGAAGG - Intergenic
1058293655 9:103277284-103277306 AAGTAGCCCTCAACCAGTGATGG + Intergenic
1060934513 9:127507423-127507445 CTGTGGCCCTGTAGCTGTGAAGG - Exonic
1062038608 9:134393817-134393839 CTGCAGCCCAGCCACAGTGAGGG - Intronic
1186590374 X:10924458-10924480 ATATAGCCCTCCACCAGTGTAGG + Intergenic
1188786957 X:34358695-34358717 CTTTAGCTTTGTACCAGTGAAGG + Intergenic
1188895537 X:35663880-35663902 TTTTAGCCCTGTACCATTGAAGG + Intergenic
1191073627 X:56429094-56429116 CTGTAGCTCTTCACCAGCAATGG - Intergenic
1191116697 X:56860334-56860356 CTGTAGGCCTGGGGCAGTGATGG - Intergenic
1192174024 X:68874700-68874722 CTGGAGCCATGGGCCAGTGACGG + Intergenic
1192705360 X:73523864-73523886 CTGAAGACCTGGACCAGTGATGG + Intergenic
1193239068 X:79144595-79144617 GTGTAGCCCTGCATCATTAACGG + Intergenic
1197827077 X:130601140-130601162 CTGTAGCCCTGGACTAGTTGTGG + Intergenic
1200522805 Y:4232182-4232204 CAGCTGCCCTCCACCAGTGAGGG + Intergenic
1201278680 Y:12321860-12321882 CTGCAGCCCTGCACCAGAGCTGG - Intergenic