ID: 952057066

View in Genome Browser
Species Human (GRCh38)
Location 3:29460476-29460498
Sequence AAAATGCCACTGATGTATCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 208}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952057066 Original CRISPR AAAATGCCACTGATGTATCT GGG Intronic
900869618 1:5292779-5292801 AAAATGCAACTGATCTGACTTGG - Intergenic
901872198 1:12144800-12144822 AAAATGCCACTGTTGTCACAAGG + Intergenic
903221794 1:21873435-21873457 AAAAAGCCTCTGATGAATTTTGG + Intronic
905117009 1:35650876-35650898 AAAATGGAAGTGATATATCTTGG + Intergenic
906216633 1:44044813-44044835 AAAATGCCAGTGCTGTTTATTGG + Intergenic
906471613 1:46135457-46135479 AATATGCCACTTAAGTATTTAGG + Intronic
907188061 1:52626498-52626520 ATGATTCCACTGATGGATCTTGG + Intergenic
909385210 1:75047257-75047279 AAAATGCTACCGATTTTTCTAGG - Intergenic
909600579 1:77457205-77457227 AGTATCCCACTGATGTACCTTGG + Intronic
911067519 1:93803883-93803905 AATATGCTATTGATGTATATAGG + Intronic
919517556 1:198545939-198545961 AAAGTTCCACTGAGGTTTCTGGG + Intergenic
919594092 1:199539846-199539868 AATAGGCCCCTGATGTCTCTTGG - Intergenic
921995836 1:221417060-221417082 AAAATGCCAGAAATGTATGTGGG - Intergenic
1063028659 10:2209135-2209157 AAAAAGCCTTTGATGTAACTTGG + Intergenic
1063722173 10:8595199-8595221 AAAAGGCCAGTGATGTATGAAGG + Intergenic
1063830762 10:9949766-9949788 AAAATGGCACTTTTTTATCTTGG + Intergenic
1066189947 10:33047008-33047030 AAAGTGTCACTGATGGTTCTGGG + Intergenic
1066762212 10:38766140-38766162 AAAATGCTACTAATGGAGCTGGG + Intergenic
1067057250 10:43059395-43059417 AAAATGCCAGCGAAGTCTCTGGG - Intergenic
1067670606 10:48317607-48317629 AAAATGGCATTGCTGTATGTAGG + Intronic
1068368289 10:56080854-56080876 GAAATGCTACTGATTTTTCTAGG - Intergenic
1070051785 10:72896450-72896472 AAAATGCCCCTTATGTATCTCGG - Intronic
1074596629 10:114873894-114873916 TAAAAGACTCTGATGTATCTTGG - Intronic
1076287126 10:129311292-129311314 ATGATGCCACTGATGTCTGTGGG - Intergenic
1078276923 11:9857816-9857838 AAAATGCCAGTAATAAATCTAGG - Intronic
1079203589 11:18395184-18395206 AAGAAGCTACTGGTGTATCTCGG + Intronic
1079400284 11:20101399-20101421 AAATTGCAACAGATGTATCGTGG - Intronic
1079852223 11:25549628-25549650 AATATGTAACTGATGTATATTGG + Intergenic
1081486719 11:43536646-43536668 GAAATGCCACTGATTTTTGTAGG + Intergenic
1082781349 11:57289821-57289843 AAAATGCCTGTCATGTCTCTTGG - Intergenic
1087702802 11:101455251-101455273 AAAATGTCACTGATTTGTCTTGG - Intronic
1088127092 11:106440704-106440726 AAAATGTTAATGATGAATCTAGG - Intergenic
1088647638 11:111929420-111929442 AAAATGCCACTGGGTTAGCTGGG + Intronic
1089977571 11:122745789-122745811 AAAATCCCACTTATCTATCAAGG + Intronic
1092268606 12:7003061-7003083 AAAATGCTACAAATGTATGTTGG - Intronic
1093255014 12:16856375-16856397 AAGATCCCACAGATGTCTCTTGG + Intergenic
1093838439 12:23865725-23865747 ATGATTCCTCTGATGTATCTTGG + Intronic
1094665543 12:32516795-32516817 AAAATGCCACTGATCTATGAAGG + Intronic
1095192822 12:39277788-39277810 AAATTGCTGGTGATGTATCTGGG - Intergenic
1095210091 12:39483750-39483772 AAAATGTTACTGATGAATCATGG + Intergenic
1096805085 12:54135757-54135779 GAAATGCCGCTAATGTATTTCGG + Intergenic
1097437885 12:59572535-59572557 AAATTGCCACAGATGAGTCTAGG - Intergenic
1097522297 12:60684783-60684805 AAAAGGCTACTGATTTAGCTTGG - Intergenic
1097811726 12:64026333-64026355 AAAATGCCTCTAATTTATTTTGG - Intronic
1099509013 12:83510607-83510629 AAAATGAGATTGCTGTATCTTGG + Intergenic
1099619079 12:84977306-84977328 AAAATGACACTAGTGTTTCTAGG - Intergenic
1100557841 12:95714723-95714745 AAAATGCCACCCATGTGTCAAGG - Intronic
1102612413 12:114124094-114124116 CAAAGGCCACTGTTCTATCTGGG + Intergenic
1107089175 13:36457961-36457983 AAAATACCAAAGATGTATGTGGG + Intergenic
1107170302 13:37333504-37333526 ATAATTCCATTGATTTATCTTGG - Intergenic
1108105071 13:47000036-47000058 AAAATGCCACAGAAATATTTAGG - Intergenic
1109953365 13:69532117-69532139 GAAATTCCTCTGATGGATCTTGG + Intergenic
1114962684 14:27913786-27913808 AAAATATCACTGATTTACCTTGG + Intergenic
1116372218 14:44150479-44150501 AAAATGCCCTTGATGTTTTTGGG - Intergenic
1116540148 14:46092202-46092224 AAAACACCACGGATATATCTAGG - Intergenic
1117411044 14:55451425-55451447 AAAATCCCAAGGTTGTATCTTGG - Intronic
1118960009 14:70520769-70520791 GTAATTCCACTGATGGATCTGGG + Intergenic
1119997219 14:79266515-79266537 AAAATGCATCTGATGTTTTTTGG - Intronic
1120356395 14:83439927-83439949 AAAAAGCCACAGATGTTTCCAGG - Intergenic
1121568662 14:94930096-94930118 AAGATGCCACAGATGTCACTAGG - Intergenic
1122966218 14:105127741-105127763 AAAATACAATTGATTTATCTGGG - Intergenic
1202933546 14_KI270725v1_random:62396-62418 AAAATGCTACTAATGGAGCTGGG + Intergenic
1125035493 15:35119431-35119453 AAAATCCTAATGAGGTATCTTGG - Intergenic
1128725969 15:69988859-69988881 AAAATGAGACTGATGTTTCTGGG + Intergenic
1134784832 16:16932608-16932630 AAAATGCCACTGTTTTTCCTTGG - Intergenic
1137630484 16:49940029-49940051 TAAATGCCTCTGAAGTATCTAGG + Intergenic
1140300267 16:73750532-73750554 AAAATGCAGATGATCTATCTGGG + Intergenic
1141560642 16:84865534-84865556 AAAAGGCAACAGATGTATTTGGG - Intronic
1142945629 17:3424183-3424205 AAAACTCCACTGATATAACTTGG + Intergenic
1146144894 17:30405943-30405965 AAAATGCTACTGAGGGATGTAGG - Intronic
1148898766 17:50858880-50858902 AAAATGCCAGACATGTATATGGG + Intergenic
1150978765 17:70118978-70119000 ACAATGCCCCTATTGTATCTTGG - Intronic
1154130043 18:11729000-11729022 CAAATGGCTCTGATGTTTCTTGG - Intronic
1155176523 18:23306057-23306079 AAAATAACACTGTTGTTTCTGGG + Intronic
1155547794 18:26932750-26932772 ACAATGCTACTGATGGATCTGGG - Intronic
1156263848 18:35468490-35468512 AAAATGCCAGTGCTGTGCCTTGG - Exonic
1158097625 18:53792298-53792320 AATATGCCACCAATGCATCTGGG + Intergenic
1158235627 18:55310141-55310163 AAAATCACACTGATGTGTTTAGG - Intronic
1158265616 18:55657923-55657945 AAACCACCACTGATGTAGCTGGG + Intronic
1159098010 18:63927161-63927183 TAAATACCACTAATGTTTCTGGG + Intronic
1159255654 18:65941958-65941980 ACACTGCCCCTCATGTATCTTGG - Intergenic
1161049016 19:2152216-2152238 ACAATCTCAATGATGTATCTCGG - Intronic
1164529790 19:29039671-29039693 AAAATGCAAATTATTTATCTGGG - Intergenic
1167425329 19:49427230-49427252 AAAATGCAACAGATGTACCCAGG + Exonic
925379623 2:3416354-3416376 AGAATGCCCCTGATGTTTCGGGG - Intronic
927296135 2:21455267-21455289 AAAATGTGACTGATTTAGCTGGG - Intergenic
928657026 2:33463009-33463031 GAAATGCCACTGTTGATTCTAGG - Intronic
929668279 2:43850650-43850672 AAAATACCACTGATGCACTTTGG + Intronic
930109881 2:47669409-47669431 AAACTGCAAGTGATGTAGCTTGG - Intergenic
930635404 2:53799299-53799321 AATCTATCACTGATGTATCTGGG + Intronic
931766178 2:65458592-65458614 AAAAGGTCAGTGATGTTTCTAGG + Intergenic
933827338 2:86174539-86174561 TTAAAGCCACTGATATATCTTGG - Intronic
935234617 2:101127963-101127985 AAAATGGATCTGAAGTATCTGGG - Intronic
937698896 2:124840921-124840943 AAGATGTCAATGATGTAACTTGG - Intronic
939561756 2:143740664-143740686 AAACTGCCCCTGCTGTACCTGGG - Intronic
941426904 2:165358454-165358476 AAAATGGCACTGCTTTATTTAGG + Intronic
941473506 2:165919979-165920001 ATAATGCCAGTTATATATCTGGG + Intronic
941876650 2:170440590-170440612 AAAATGCAACTGAATTAGCTGGG + Intronic
942018886 2:171847002-171847024 AAAATGACACTTCTGTATTTGGG - Intronic
942074749 2:172346973-172346995 AGAATGTCAGTGATGTATCATGG - Intergenic
942663096 2:178287289-178287311 ACAATGTGTCTGATGTATCTAGG - Intronic
942891642 2:180996820-180996842 AAAATCACACAAATGTATCTTGG - Intronic
943081822 2:183265428-183265450 AAAAAGACACTGCTGTATTTTGG + Intergenic
943940653 2:193989944-193989966 AAAATTCCATTGCTATATCTTGG - Intergenic
944191800 2:197011019-197011041 AACATTCCATTTATGTATCTCGG + Intronic
1169501334 20:6163497-6163519 ACAATGCCACTGAGGTATTCAGG - Intergenic
1170211058 20:13846659-13846681 TGAAAGCCACTGATGTTTCTCGG - Intergenic
1170373075 20:15670574-15670596 AAAATGTCTCAGATGTATTTGGG - Intronic
1172429781 20:34879997-34880019 TAAATGCCATTCATGTATCAGGG - Intronic
1173489083 20:43464986-43465008 AAAATGCAACCAATGAATCTTGG - Intergenic
1173829394 20:46070961-46070983 AAAATGCACTTGAAGTATCTTGG + Intronic
1174613171 20:51815720-51815742 AACATGACACTGATGTGTCAAGG + Intergenic
1174842298 20:53911775-53911797 AAAATGACACTGATGCTTCTCGG + Intergenic
1175058888 20:56223500-56223522 AACATGCCACTGATGGCTCAAGG + Intergenic
1177057448 21:16325154-16325176 AAAATGACTCTGATGTCTATGGG + Intergenic
1177357578 21:20029767-20029789 AAAAGGCCAGTGATTTATCTAGG - Intergenic
1177575823 21:22954304-22954326 AAAAAGTCACTGTTGTACCTGGG + Intergenic
1177974845 21:27835324-27835346 ACAATGCCACAGATGTACATTGG - Intergenic
1177986508 21:27981636-27981658 AAAATGCCACTTATATGGCTGGG - Intergenic
1179480699 21:41676086-41676108 AAATTTCCACTGAAATATCTTGG - Intergenic
1180585030 22:16880545-16880567 AAAATGCTACTAATGGAGCTGGG + Intergenic
949380820 3:3443826-3443848 AAAATGGCAATGAAGTTTCTCGG - Intergenic
950475121 3:13210187-13210209 CAAATGCCACTTATGTGGCTTGG + Intergenic
950882223 3:16331636-16331658 AAAATGGAACTAATGTATTTAGG - Intronic
952057066 3:29460476-29460498 AAAATGCCACTGATGTATCTGGG + Intronic
952447508 3:33396291-33396313 AAGATGCCACTGATGAGCCTGGG + Intronic
953395467 3:42565979-42566001 AAAATACTACTGAAGTATCCAGG + Intronic
955012964 3:55037436-55037458 AAAGTGCCACTGATGTCTGAGGG - Intronic
957272177 3:78045089-78045111 AAAACTCCACTGAAGCATCTAGG - Intergenic
957416250 3:79909297-79909319 AAAAAGACACAGATGTAGCTAGG + Intergenic
958935699 3:100253292-100253314 AAAATGTCCCTGCTGTATTTTGG + Intergenic
959034939 3:101350180-101350202 AAAATGCAACTCATGTGTCAGGG + Intronic
960068252 3:113398799-113398821 AAAATGCCATGGAAGTATTTGGG - Intronic
960386247 3:117025260-117025282 AATATGCCACTAATGTAACAAGG - Intronic
969143200 4:5098077-5098099 ATAATGCGAGTGATGTTTCTTGG - Intronic
970296082 4:14632015-14632037 AAAATGTAATTGATTTATCTGGG - Intergenic
971535450 4:27742816-27742838 AAAATGCAACTAGTGAATCTTGG - Intergenic
971934086 4:33124702-33124724 AAAATGCTATTTATGTATATTGG + Intergenic
973164641 4:47061979-47062001 AATATGACACTGATCTATCTTGG - Intronic
973849939 4:54951343-54951365 ATAATTCCTCTGATGAATCTGGG - Intergenic
975961968 4:79920248-79920270 AAAATGCAAACGATGTGTCTGGG + Intronic
980752202 4:137105865-137105887 AAAATGTCACTGATGAATTTGGG + Intergenic
983411828 4:167408750-167408772 AAAAGGCCAGTGTTATATCTAGG - Intergenic
986988978 5:13529659-13529681 AAAATACCACTGATCTATACTGG + Intergenic
987122628 5:14781398-14781420 AAAACACCACTGTTGTATTTTGG - Intronic
987189446 5:15459589-15459611 TAAATGCCACTGATTTTTGTAGG + Intergenic
988125985 5:27037912-27037934 AAAATGCCACAGATGCATATTGG - Intronic
988733674 5:33999099-33999121 AAAATGCTAGTGATTTAGCTAGG + Intronic
990462947 5:56046645-56046667 AACAGGCTACTGATGTAACTGGG + Intergenic
990819349 5:59819892-59819914 AAAACGCCTCTGTTGTCTCTAGG - Intronic
991043494 5:62198709-62198731 AAAATGCCACCCATGTGTTTTGG + Intergenic
994958520 5:106566098-106566120 GAAATGCCACTGAAGTATTCAGG + Intergenic
996431468 5:123383470-123383492 AAAATGCCCCTGATGTAAATAGG - Intronic
996501485 5:124221877-124221899 AAAATGCCACTGAGTTAACCAGG - Intergenic
998979956 5:147691113-147691135 AAAATAAAACTCATGTATCTGGG - Intronic
999207702 5:149861898-149861920 AAAATGGCAGTGAGGTATCCTGG - Intronic
999323102 5:150626707-150626729 AAAATGCCACGGAAGAACCTAGG - Intronic
999398170 5:151244058-151244080 AATATGCCACTGAGGTGGCTGGG + Intronic
999972147 5:156875533-156875555 AAAATACCGCTGAAGTATTTAGG + Intergenic
1000093752 5:157952830-157952852 AAAATGTCACTGAATTATATCGG - Intergenic
1000405856 5:160887752-160887774 AAAAAGCCACACAGGTATCTTGG - Intergenic
1000693855 5:164355958-164355980 AAAATGACGCTGATGTATTTAGG + Intergenic
1001888444 5:175317624-175317646 AACATGCAAATGATTTATCTGGG - Intergenic
1002778167 6:346277-346299 AAAAAGCCACTGAGGTTTCAAGG - Intronic
1003721517 6:8708342-8708364 AAACTGCCACTCAGGTCTCTTGG + Intergenic
1009042679 6:58198813-58198835 ACAATGACAATGATTTATCTTGG + Intergenic
1009218517 6:60953044-60953066 ACAATGACAATGATTTATCTTGG + Intergenic
1010024269 6:71197520-71197542 TAAATGACAATGACGTATCTGGG + Intergenic
1010942120 6:81931324-81931346 GAAGTGGCACTGGTGTATCTTGG + Intergenic
1011205029 6:84883193-84883215 AATATGCCAATGGTGTACCTTGG - Intergenic
1012607515 6:101176133-101176155 AAAATTCCACTAATATATCCTGG + Intergenic
1013899217 6:115132589-115132611 TAAAATCCACTGATCTATCTTGG + Intergenic
1014898061 6:126928102-126928124 AAAATTCGACTGAAGTGTCTTGG - Intergenic
1017711766 6:157175698-157175720 AAAATGTCACGGATGTATCAGGG + Intronic
1018224294 6:161613050-161613072 AAAAGTCCTCTGATGGATCTGGG + Intronic
1018843512 6:167536840-167536862 ATAATTCCTCTGATGGATCTGGG - Intergenic
1019878577 7:3838363-3838385 CAATTCCCACTGATGTGTCTGGG - Intronic
1019895841 7:3982472-3982494 ATAATTCCTCTGATGGATCTGGG + Intronic
1020517927 7:9148336-9148358 AAAATGTCACAGCTCTATCTTGG + Intergenic
1021227302 7:18043181-18043203 AAAATGACACTGATGAACCCTGG + Intergenic
1021700378 7:23314001-23314023 AAAATGCAACTGATGTCTCATGG - Intronic
1022373682 7:29793000-29793022 AAGATGCCACTGAAGTAGTTTGG - Intergenic
1023285677 7:38616496-38616518 AAAAAACCACTTATTTATCTTGG - Intronic
1024741232 7:52356998-52357020 GAAATGCCACTCAGGCATCTAGG + Intergenic
1025242122 7:57285815-57285837 AAAATTCCACTGATGAAGCCAGG - Intergenic
1026595209 7:71728982-71729004 AAAATGGCAGTGATATCTCTTGG - Intergenic
1027528995 7:79306688-79306710 ACAATGCCACTGAAGTGTCATGG - Intronic
1027939031 7:84649000-84649022 AACATGACACTGATGTATCCAGG + Intergenic
1028348833 7:89818402-89818424 AAAATGAAACTAATGTTTCTTGG - Intergenic
1028754425 7:94419349-94419371 AGAAGGCCTCTGATGTATTTTGG - Intronic
1028862402 7:95667982-95668004 AAAAAGTCACTGATGTTTTTGGG - Intergenic
1031528374 7:122848914-122848936 AAAATGCTCCTGAAGTATTTTGG + Intronic
1032549923 7:132775407-132775429 AACATGCAATTGATGTTTCTTGG + Intergenic
1033092247 7:138396653-138396675 AAAATGCCCCAGGTGTTTCTGGG - Intergenic
1035134091 7:156683947-156683969 AAAATGGCACTGATAGGTCTAGG + Exonic
1037078245 8:14749396-14749418 AACATTCCACTGATGTGTGTGGG + Intronic
1037942292 8:22960719-22960741 AAAATGACACTGATTTGTTTTGG - Intronic
1037958691 8:23079503-23079525 AAAATGCCACTGATTTTCTTTGG - Intergenic
1038668354 8:29561334-29561356 ACAATGCCACTGATGAAACAAGG - Intergenic
1038844350 8:31215084-31215106 AAAATGCCAATCATGAATCAGGG - Intergenic
1039806875 8:41007630-41007652 AAAATGTGAATGATGCATCTTGG + Intergenic
1041160017 8:55030977-55030999 AAAGTTCCACTAATGTATGTTGG - Intergenic
1042396245 8:68294830-68294852 AAAATGCCAATGATTTATTTTGG + Intergenic
1043097275 8:75991273-75991295 AAAAGCACACTGATGCATCTGGG - Intergenic
1043251656 8:78081919-78081941 AACTTGTCACTGATGTATTTAGG + Intergenic
1044025351 8:87163629-87163651 AAAATGCAACTGATATTTGTAGG + Intronic
1044718769 8:95125650-95125672 AAAATGACACACATGTCTCTTGG - Intergenic
1045586457 8:103543191-103543213 AAAATGCTACTGATTTGTGTAGG - Intronic
1045790877 8:105982927-105982949 AAAATGCTACTAATCTTTCTAGG - Intergenic
1049143704 8:140981464-140981486 AAAATCCCACTGTTGAAGCTGGG + Intronic
1051009951 9:12399466-12399488 ATAATTCCACTGATGGATCTGGG + Intergenic
1052043943 9:23773002-23773024 AAAAAGTCACAGATGTACCTAGG - Intronic
1052118070 9:24673335-24673357 AAAAAGTCACTGTTTTATCTGGG + Intergenic
1055065608 9:72115082-72115104 AAAATGCCACTTAATTTTCTGGG - Intronic
1055434814 9:76281994-76282016 GAGATTCCTCTGATGTATCTGGG + Intronic
1061770767 9:132919393-132919415 AAATTTCCAGTGATGTATGTTGG - Intronic
1187664856 X:21595469-21595491 ATAATGTCACTGAAGTTTCTAGG + Intronic
1188482520 X:30650151-30650173 AAAATGTCACTGACGTAGATGGG - Intergenic
1188501161 X:30828110-30828132 AAAATATCAATGATGTATCCTGG - Exonic
1188657602 X:32717351-32717373 AAAAGGCCCCAGATGTGTCTTGG + Intronic
1188835918 X:34954100-34954122 GAGATTCCAATGATGTATCTGGG + Intergenic
1190997639 X:55625714-55625736 AAAACTCCACTGATGTCTCTTGG - Intergenic
1192762687 X:74110567-74110589 AAAATGCTACTGACTTATGTAGG - Intergenic
1193772831 X:85607524-85607546 AAAATGCCAGTGATGATTATTGG - Intergenic
1194629623 X:96267871-96267893 TATATGCAACTGATATATCTGGG + Intergenic
1198091197 X:133331931-133331953 AAAATGTCACTGAAATATCTGGG - Intronic
1199846687 X:151696668-151696690 AAAATGGAGCTGTTGTATCTGGG - Intronic
1200125074 X:153809596-153809618 AAAATGCCACTACTGTTTTTTGG + Intronic
1201707626 Y:16954489-16954511 CAAATGCCACTGATATTTATTGG - Intergenic