ID: 952057969

View in Genome Browser
Species Human (GRCh38)
Location 3:29473049-29473071
Sequence GCATTCACAAACCTTGAGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 295
Summary {0: 1, 1: 21, 2: 20, 3: 63, 4: 190}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952057964_952057969 20 Left 952057964 3:29473006-29473028 CCACGTCCCCATCAGAGTAGCTA 0: 1
1: 23
2: 729
3: 1490
4: 2015
Right 952057969 3:29473049-29473071 GCATTCACAAACCTTGAGCTAGG 0: 1
1: 21
2: 20
3: 63
4: 190
952057966_952057969 13 Left 952057966 3:29473013-29473035 CCCATCAGAGTAGCTAGATACAG 0: 7
1: 695
2: 1761
3: 1153
4: 946
Right 952057969 3:29473049-29473071 GCATTCACAAACCTTGAGCTAGG 0: 1
1: 21
2: 20
3: 63
4: 190
952057965_952057969 14 Left 952057965 3:29473012-29473034 CCCCATCAGAGTAGCTAGATACA 0: 8
1: 678
2: 1899
3: 1160
4: 929
Right 952057969 3:29473049-29473071 GCATTCACAAACCTTGAGCTAGG 0: 1
1: 21
2: 20
3: 63
4: 190
952057967_952057969 12 Left 952057967 3:29473014-29473036 CCATCAGAGTAGCTAGATACAGA 0: 7
1: 645
2: 1722
3: 1191
4: 1050
Right 952057969 3:29473049-29473071 GCATTCACAAACCTTGAGCTAGG 0: 1
1: 21
2: 20
3: 63
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952057969 Original CRISPR GCATTCACAAACCTTGAGCT AGG Intronic
902148055 1:14420350-14420372 GCATTTACAAACCTTGAGCTAGG + Intergenic
906003781 1:42450437-42450459 AAATTGACAAACCTTTAGCTAGG - Intronic
906876243 1:49541974-49541996 GTGTTTACAAACCTTGAGCTGGG - Intronic
909359650 1:74745564-74745586 GCATTTACAATCCTCTAGCTAGG + Intronic
909759331 1:79269615-79269637 GTATTTACAATCCCTGAGCTAGG - Intergenic
912437235 1:109670278-109670300 GCATTTACAATCCTTTGGCTAGG + Intronic
915137446 1:153743053-153743075 TCATTCAGAGACCTTGAGCCAGG + Intronic
915618541 1:157062192-157062214 AAATTAACAAACCTTTAGCTAGG - Intergenic
918796026 1:188897828-188897850 GCATTTACAATCCTTTAGCTAGG + Intergenic
918813027 1:189145159-189145181 AAATTGACAAAACTTGAGCTAGG + Intergenic
922546902 1:226464539-226464561 GCATTTACAAACCTTGAGCTAGG - Intergenic
923288684 1:232522450-232522472 GCCTTCTCAAACCTTAAGGTTGG + Intronic
1063859425 10:10291554-10291576 GCATTTACAATCCTTTAGCTAGG + Intergenic
1065583680 10:27196851-27196873 GCATTCACAACTCTTGAGTTTGG - Exonic
1065995603 10:31056356-31056378 GTGTTCACAAACCTTGAGCTAGG - Intergenic
1066016734 10:31252908-31252930 AAATTGACAAACCTTTAGCTAGG - Intergenic
1066045062 10:31587742-31587764 GCATTTACAATCCTTTCGCTAGG + Intergenic
1066296213 10:34056218-34056240 GCGTTTACAATCCCTGAGCTAGG - Intergenic
1069967842 10:72136236-72136258 GCATTTACAATCCTCTAGCTAGG - Intronic
1070330646 10:75414573-75414595 ACTTTCCCAAACCTTGACCTTGG + Intergenic
1070983244 10:80666972-80666994 GCATTCACATTCCTTGTTCTGGG + Intergenic
1070999251 10:80814858-80814880 GCATTTACAATCCCTGAGCTAGG - Intergenic
1071963671 10:90831797-90831819 GTATTTACAAACCCTGAGCTAGG + Intronic
1072278599 10:93845856-93845878 GCGTTTACAATCCCTGAGCTAGG - Intergenic
1073073477 10:100809173-100809195 GCATCCACCAACCCTGAGCTGGG + Exonic
1073262369 10:102200402-102200424 GTGTTTACAAACCTTGAGCTAGG + Intergenic
1073849241 10:107595323-107595345 TTTTTCACAAACCTTGTGCTTGG + Intergenic
1073864373 10:107784947-107784969 GCCTTCAGACACCTTGAGCAGGG + Intergenic
1073970380 10:109041082-109041104 GCATTTACAAACCTTTAGCTAGG - Intergenic
1076067387 10:127459575-127459597 GCATTTACAAACCTTTAGCTAGG + Intergenic
1076579511 10:131497246-131497268 TCATTCAGAAACTTTGACCTGGG + Intergenic
1077352036 11:2097551-2097573 GCAGCCACAGACCATGAGCTTGG + Intergenic
1077992535 11:7424785-7424807 GTATGCACAAAGGTTGAGCTTGG - Intronic
1079756709 11:24274068-24274090 GCATTCACAAACCCTGAGTTAGG + Intergenic
1081217004 11:40413317-40413339 GCATTCACACACCTTACACTCGG + Intronic
1082186204 11:49185011-49185033 GCATTAACAACCCTAAAGCTAGG - Intronic
1083732726 11:64661447-64661469 GCATGCCGAAATCTTGAGCTCGG + Intronic
1084152531 11:67296958-67296980 AAATTGACAAACCTTTAGCTAGG - Intronic
1084357170 11:68647664-68647686 GTATTCTCCCACCTTGAGCTTGG + Intergenic
1084406061 11:68974390-68974412 GCGTTTACAATCCCTGAGCTAGG + Intergenic
1084840648 11:71843722-71843744 GCATTTACAGTCCTTTAGCTAGG + Intergenic
1086680125 11:89660359-89660381 GCATTAACAACCCTAAAGCTAGG + Intergenic
1086858126 11:91891479-91891501 TCATTCAAAATCATTGAGCTAGG + Intergenic
1087847143 11:102986267-102986289 GCATTCAGAAACCTTGATTTGGG - Intergenic
1088996415 11:115002313-115002335 AAATTTACAAACCTTTAGCTCGG + Intergenic
1091164392 11:133460445-133460467 ACATTGACAAACTTTTAGCTAGG + Intronic
1091256198 11:134188173-134188195 GCATTTATAATCCTTTAGCTGGG - Intronic
1092336791 12:7640524-7640546 GCGTTTACAATCCCTGAGCTAGG - Intergenic
1093741282 12:22692903-22692925 GCATTTACAAACCTTGAGCTAGG + Intergenic
1094000264 12:25686986-25687008 GTATTTACAATCCTTTAGCTAGG - Intergenic
1095642491 12:44501156-44501178 GCATTTACAAACCTTTAGCTAGG - Intergenic
1097253785 12:57656331-57656353 GCATCCACAAACCCCGAGCTAGG - Intergenic
1097491036 12:60270229-60270251 GCATTTACAAACCTTTAGCTAGG - Intergenic
1098110688 12:67118468-67118490 GCATTGAGAAACCAAGAGCTGGG - Intergenic
1098114408 12:67159849-67159871 GCATTCATAAACATTGACCTTGG + Intergenic
1100734528 12:97512568-97512590 GCATTCACAAACCCTGGGCTAGG + Intergenic
1101021729 12:100559994-100560016 GTATTTACAATCCCTGAGCTAGG - Intronic
1102730174 12:115102204-115102226 GCCTTCACTAACCATGGGCTAGG - Intergenic
1103965963 12:124639490-124639512 GTATTCGCCAACCCTGAGCTTGG - Intergenic
1104369506 12:128211332-128211354 CCACACACAAACCTTGAGCCAGG + Intergenic
1105477296 13:20739636-20739658 GCATTTACAAACCTTGAACTAGG + Intronic
1106081208 13:26501471-26501493 TCATTCCCTAACCTTGATCTTGG + Intergenic
1108157041 13:47595975-47595997 GAGTTTACAAACCTTTAGCTAGG - Intergenic
1108845780 13:54677265-54677287 GCATTTACAAACCTTGAGCTAGG - Intergenic
1109007877 13:56901504-56901526 GCGTTTACAATCCCTGAGCTAGG - Intergenic
1109149190 13:58823568-58823590 GCGTTTACAATCCTTTAGCTAGG + Intergenic
1109699757 13:66009842-66009864 GCATTTACAATCCCTTAGCTAGG - Intergenic
1111710236 13:91802609-91802631 CCATCTACAAACCTTTAGCTAGG + Intronic
1111729274 13:92052561-92052583 TCATTTACAATCCTTTAGCTAGG + Intronic
1111730305 13:92066947-92066969 ACATTTACAAACACTGAGCTAGG + Intronic
1112932109 13:104753670-104753692 GCATTCAAGAAGCTTGTGCTGGG + Intergenic
1115145861 14:30224889-30224911 GCATTCACAAACCCTATCCTTGG - Intergenic
1116050941 14:39802340-39802362 GCTTTCACAAACCTGGAGGAGGG + Intergenic
1116084347 14:40216820-40216842 GCCTTTACAAACCTTTAGCTAGG + Intergenic
1116152007 14:41153912-41153934 GCGTTTACAATCCCTGAGCTAGG + Intergenic
1116325914 14:43533688-43533710 GCATCCACAAACCCCAAGCTAGG - Intergenic
1116653878 14:47627201-47627223 GCATTCACAAACCCTGAGCTAGG - Intronic
1117727245 14:58687094-58687116 GCATTTACAAACCTTGAGCTAGG + Intergenic
1117856923 14:60044204-60044226 AAATTGACAAACCTTTAGCTGGG - Intronic
1118305905 14:64655226-64655248 GCACTCACAAACCTTCAGCTGGG - Intergenic
1119885505 14:78137276-78137298 GCTCTCACAATCCTTGAGATTGG + Intergenic
1120209746 14:81623300-81623322 GTATTTACAAACCCTGAGCTAGG + Intergenic
1121311512 14:92937863-92937885 GGATTCAGAGACCTTGAGCTGGG - Exonic
1121350569 14:93169979-93170001 GTATTTACAATCCCTGAGCTAGG + Intergenic
1122807572 14:104267909-104267931 GCGGTCACAGACCATGAGCTGGG - Intergenic
1123051986 14:105548422-105548444 GCATCCACAAACCCTGAGCTAGG - Intergenic
1124598327 15:31109962-31109984 GGATTCACAAAACTTTTGCTTGG - Intronic
1124828963 15:33129065-33129087 GCATTTACAATCCTCTAGCTAGG + Intronic
1125417242 15:39466646-39466668 GCATTCAGAAGCCCTGACCTTGG + Intergenic
1125584166 15:40808476-40808498 GCATTCACCAACCTGGATTTTGG + Intronic
1126191843 15:45886221-45886243 GCATTTACAAACCTTTAGCTAGG - Intergenic
1126825505 15:52543941-52543963 CCTTTCACTAACTTTGAGCTTGG + Intergenic
1127449240 15:59100775-59100797 GCGTTCAGAAAGCTTGTGCTAGG - Intergenic
1128546565 15:68572611-68572633 TGATTCAGAAACCTGGAGCTGGG - Intergenic
1129188937 15:73926655-73926677 GCATGGACAAAGCTAGAGCTGGG + Exonic
1129197035 15:73974414-73974436 GCGTTTACAATCCCTGAGCTAGG - Intergenic
1130199723 15:81813726-81813748 GCATTCACAAAGCTACAGCAGGG - Intergenic
1130958834 15:88646421-88646443 GCATTCACACACACTGAGCATGG - Intronic
1131250348 15:90826050-90826072 GCATTCACAAACCCTGAGCTAGG - Intergenic
1131845994 15:96491487-96491509 GCCTTTACAATCCCTGAGCTAGG + Intergenic
1134675350 16:16086327-16086349 GCCTGCACAAACCTGGAGCCAGG - Intronic
1137534837 16:49312217-49312239 GCATTCACACACCCTGATCCCGG - Intergenic
1140185926 16:72771988-72772010 GCGTTTACAATCCTTTAGCTAGG - Intergenic
1141909472 16:87048721-87048743 CCTTACACAAACCTTTAGCTTGG - Intergenic
1143460408 17:7100297-7100319 GCGTTTACAATCCCTGAGCTAGG + Intergenic
1144721218 17:17471132-17471154 TTATTGACAAACCTTGTGCTGGG - Intergenic
1144748605 17:17633089-17633111 GTGTTTACAAACCTTTAGCTAGG + Intergenic
1145734831 17:27220976-27220998 ACATTCACAAAAATTGACCTGGG + Intergenic
1149887650 17:60356671-60356693 GCAGTAACAAACCTTAAGGTAGG + Intronic
1152350530 17:79781791-79781813 GCAGCCACCCACCTTGAGCTTGG - Exonic
1152494980 17:80664627-80664649 GCACTCAGAATCCTTGACCTTGG + Intronic
1153431192 18:5019081-5019103 GCCTTCACAATCCTTTAGCTAGG + Intergenic
1154942878 18:21132361-21132383 GCATCCACAAATCCGGAGCTAGG + Intergenic
1156741383 18:40333352-40333374 AAATTGACAAACCTTCAGCTAGG - Intergenic
1159472832 18:68879700-68879722 GTATTTACAATCCCTGAGCTAGG + Intronic
1159501017 18:69270146-69270168 AGATTGACAAACCTTAAGCTAGG + Intergenic
1161422382 19:4182916-4182938 GCATTCAAAACCCTTAGGCTGGG - Intergenic
1162987208 19:14278404-14278426 GCGTTTACAATCCCTGAGCTAGG - Intergenic
1164539699 19:29113694-29113716 CCATCCATAAACGTTGAGCTGGG - Intergenic
1168495938 19:56851114-56851136 AAATTGACAAACCTTTAGCTAGG - Intergenic
924967465 2:91526-91548 GCATTTACAAAACCTGAGCTAGG - Intergenic
925950302 2:8903130-8903152 GCATTTACAAACCTTTAACTAGG + Intronic
926750214 2:16192788-16192810 GAATTCTCTCACCTTGAGCTTGG + Intergenic
926850760 2:17194214-17194236 GCGTTTACAATCCCTGAGCTAGG - Intergenic
930519475 2:52446724-52446746 GGATTTACACACCTTTAGCTAGG - Intergenic
930883139 2:56294520-56294542 GCACTCACTGACCTTGATCTAGG + Intronic
933050028 2:77591170-77591192 GCATTTACAAACCTTGAGCTAGG - Intronic
933980641 2:87547656-87547678 GGATTCAGGAGCCTTGAGCTGGG - Intergenic
934867854 2:97829273-97829295 GCATTTACAATCCTTTAGCTAGG - Intronic
936313186 2:111403135-111403157 GGATTCAGGAGCCTTGAGCTGGG + Intergenic
937751331 2:125478979-125479001 GGGTTTACAAACCTTGAGCTAGG + Intergenic
938805565 2:134804184-134804206 GCATTTACAAATCTTTAGCAAGG + Intergenic
941309360 2:163910220-163910242 ACATTTACAAACCTTGAGCTAGG - Intergenic
942777762 2:179605062-179605084 GCATCCAAAATCCTTGAGATAGG - Intronic
943365394 2:186963005-186963027 GCATTTACAAACCTTGAGCTAGG - Intergenic
944861742 2:203821791-203821813 ACATTCATAAAGCTGGAGCTGGG - Intergenic
945825759 2:214717903-214717925 GCATTTACAATCCTTTAGCTAGG + Intergenic
945870314 2:215219677-215219699 GCATTCACAATCCGTTAGCTAGG - Intergenic
946054095 2:216885879-216885901 GCGTTTACAATCCCTGAGCTAGG - Intergenic
946152670 2:217787094-217787116 GCATCCACAAACCCTGAGCAAGG + Intergenic
946314820 2:218903909-218903931 GCATTAATAAAGCTTGAGCCGGG - Intergenic
947975615 2:234363182-234363204 GCATTCACAAATGTTAAGCAGGG - Intergenic
1169554033 20:6730930-6730952 GCATTTCCAAACCCTGTGCTGGG + Intergenic
1169891016 20:10452130-10452152 TAATTCACAAGCCTTGAGCATGG - Intronic
1171950847 20:31420448-31420470 GCCCTCACAAACCGTGATCTTGG - Intergenic
1175434569 20:58934631-58934653 TAATTGACAAACCTTTAGCTAGG + Intergenic
1175532799 20:59685526-59685548 GCATTCACCAGCCTTGTGCTGGG - Intronic
1180756589 22:18166164-18166186 GAATCCATAAACCTGGAGCTAGG - Intronic
1181075179 22:20371269-20371291 GAATCCATAAACCTGGAGCTAGG + Intronic
1184028225 22:41874099-41874121 GTATTCACTTACCTTGAGCCTGG - Intronic
1185229007 22:49669837-49669859 TGATTTACAAACCTTGAGCTAGG + Intergenic
1185229024 22:49669989-49670011 TGATTTACAAACCTTGAGCTAGG + Intergenic
949259072 3:2084123-2084145 GTATTTACAATCCCTGAGCTAGG - Intergenic
949259112 3:2084449-2084471 GTATTTACAATCCCTGAGCTAGG - Intergenic
950207980 3:11094536-11094558 GTGTTTACAAACCTTGAGCTAGG - Intergenic
950601323 3:14037702-14037724 GCATTTACAATCCTTTAGCTAGG - Intronic
950852621 3:16077239-16077261 GTATTTACAATCCTTTAGCTAGG - Intergenic
951332866 3:21387075-21387097 GTGTTTACTAACCTTGAGCTAGG + Intergenic
951779300 3:26345665-26345687 GCATTCACAAACCATGCTCCTGG + Intergenic
952011170 3:28902753-28902775 GCATTTACAATCCCTGAGCTAGG + Intergenic
952057969 3:29473049-29473071 GCATTCACAAACCTTGAGCTAGG + Intronic
952958498 3:38575476-38575498 GCATTCACAGGCCCTGAGGTGGG - Intronic
954230486 3:49213243-49213265 GCATTTACAAACCTTGAGCTAGG + Intronic
954598563 3:51850033-51850055 GTGTTTACAAACCTTTAGCTAGG - Intergenic
957510589 3:81182731-81182753 GCATTTACAAACCTTTAGCTAGG + Intergenic
957510594 3:81182863-81182885 GCATTTACAATCCTTTAGCTAGG + Intergenic
958700182 3:97579133-97579155 ATAATCACAAACCTTGAGTTTGG - Intronic
960063312 3:113346383-113346405 GCACTTACAATCCTTTAGCTAGG - Intronic
962512399 3:136114909-136114931 GCAGTCTCAAACGTTGTGCTGGG - Intronic
962590953 3:136889656-136889678 GCGTTTACAATCCCTGAGCTAGG + Intronic
963021735 3:140878427-140878449 GCATTTACAATCCTTTAGCTAGG - Intergenic
963403098 3:144826562-144826584 GCATTTACAAACCTTTAGCTAGG + Intergenic
964378632 3:156073815-156073837 GCATTCACAAACCCTGAGCTAGG - Intronic
965943337 3:174211338-174211360 GCGTTTACAATCCCTGAGCTAGG + Intronic
966245983 3:177808775-177808797 GGTGTGACAAACCTTGAGCTAGG + Intergenic
970574469 4:17413928-17413950 GCATTTACAATCCTTTAGCTAGG + Intergenic
972913408 4:43846791-43846813 GCATTTACAATCCTGTAGCTAGG - Intergenic
973031643 4:45349253-45349275 GCAGACACAAACTTTGAGCCTGG - Intergenic
973142194 4:46782408-46782430 GCATTTACAATCCTTTAGCTAGG - Intronic
973146417 4:46831585-46831607 GTGTTTACAAACCTTGAGCTAGG - Intronic
974292568 4:59951801-59951823 ACATTGACAAACCTTTAGCCAGG + Intergenic
974827873 4:67152545-67152567 GCCTTTACAATCCCTGAGCTAGG - Intergenic
976596967 4:86904012-86904034 GCATTTACAATCCTTTAGCTAGG + Intronic
978346224 4:107773032-107773054 GGATTAACATACCTAGAGCTGGG - Intergenic
978809182 4:112831302-112831324 GCATTTACAATCCTTTAGCTAGG - Intronic
979269211 4:118740220-118740242 GCCCTCAGAAACCTTGATCTTGG + Intronic
980363538 4:131768398-131768420 GCATTCACTGAACTTGAACTTGG - Intergenic
981176475 4:141689484-141689506 GCATTCACAAACCCTGAGCTAGG + Intronic
982063707 4:151631220-151631242 AGATTCACAAACCTTTAGCTAGG + Intronic
983660610 4:170127549-170127571 GCCTTTACAAACCTTTAGCTAGG + Intergenic
983834142 4:172369226-172369248 GCATTTACAATCCTCTAGCTAGG + Intronic
983922322 4:173359238-173359260 GCATTTACAACCCTTTAGCTAGG - Intergenic
984180484 4:176476807-176476829 GCGTTTACAATCCTTTAGCTAGG + Intergenic
986044753 5:4026412-4026434 ACATACACAAACCTTGACCTAGG + Intergenic
987923273 5:24310498-24310520 GCATTTACAATCCTTTAGCTAGG - Intergenic
988291645 5:29296036-29296058 GCCTTTACAATCCCTGAGCTAGG + Intergenic
989759139 5:44991007-44991029 GAATGGACAAACCTTTAGCTTGG + Intergenic
990367325 5:55084586-55084608 GCATTTACAATCCTTTAGCTAGG + Intergenic
991127855 5:63087955-63087977 GCATTAATAAACCCTGAGTTAGG - Intergenic
991215038 5:64150567-64150589 GCACTCACAATCCCTTAGCTAGG - Intergenic
991514646 5:67421226-67421248 GCATTCAAAGACCTTATGCTTGG + Intergenic
993202101 5:84829980-84830002 GCGTTTACAAACCTTTAGCTAGG + Intergenic
993415722 5:87627666-87627688 ACATTAACATACTTTGAGCTGGG - Intergenic
994096452 5:95851823-95851845 GCATTCACAAACCCTGAGCTAGG - Intergenic
994239957 5:97407692-97407714 GCATTTACAAACCCAGAGCTAGG - Intergenic
995920537 5:117305598-117305620 GTATTTACAATCCCTGAGCTAGG - Intergenic
996478592 5:123948852-123948874 GTATTTACAGACCTTGAGCTAGG + Intergenic
999370624 5:151052855-151052877 CCTTCCACAAACTTTGAGCTGGG - Intronic
1000535447 5:162472576-162472598 GCATTTACAATCCTTTAGCTAGG - Intergenic
1002435558 5:179228802-179228824 GCATCCACAACTCTGGAGCTAGG + Intronic
1002556446 5:180045735-180045757 GCATTTACAATCCTCCAGCTAGG + Intronic
1003581552 6:7344922-7344944 GCGTTTACAATCCCTGAGCTAGG - Intronic
1003806146 6:9727748-9727770 GCATTTACAAACCTTTACCTAGG - Intronic
1003881289 6:10482393-10482415 GCATTTACAAACCTTGAGCTAGG + Intergenic
1003901717 6:10660665-10660687 GCATTCACAATCCCTTAGCTAGG - Intergenic
1003947365 6:11087711-11087733 GTATTTACAATCCCTGAGCTAGG - Intergenic
1004037080 6:11933694-11933716 GTATTTACAATCCCTGAGCTAGG - Intergenic
1005355789 6:24981973-24981995 CCTTTCACAGACCCTGAGCTGGG + Intronic
1005766429 6:29015856-29015878 GCATTTACAAACCTTGAGCTAGG - Intergenic
1006033730 6:31195999-31196021 GCACTCACAAACCCTGAGCTAGG - Intergenic
1006759736 6:36449549-36449571 GCGTTTACAATCCTTTAGCTAGG + Intronic
1006853717 6:37118037-37118059 GCATTTAAAAGCTTTGAGCTGGG + Intergenic
1010159459 6:72835128-72835150 ACATTGACCATCCTTGAGCTGGG - Intronic
1010485657 6:76410225-76410247 CAATTAACAAACCTTTAGCTAGG - Intergenic
1012228094 6:96728257-96728279 CCATTCACAAACCTTGGTTTAGG - Intergenic
1012789636 6:103676943-103676965 GCGTTTACAATCCTTTAGCTAGG + Intergenic
1014579045 6:123111824-123111846 GCATTTACAAACCTTTAGCTAGG - Intergenic
1014940164 6:127428921-127428943 GCATTTACAAACCTTTAGCTAGG + Intergenic
1017017755 6:150115739-150115761 GCATTTACAATCCTTTGGCTAGG + Intergenic
1017537469 6:155363609-155363631 GTGTTTACAAACCTTGAGCTAGG - Intergenic
1017919522 6:158859099-158859121 GCATTCACTAACCTGGAGGCAGG - Intergenic
1019944157 7:4313681-4313703 GTATTTACAATCCTTGAGCTAGG + Intergenic
1019965647 7:4496674-4496696 GTATTTACAATCCTTGAGCTAGG + Intergenic
1020164028 7:5794232-5794254 CTATTTACAAACCCTGAGCTAGG - Intergenic
1020332465 7:7033323-7033345 GCATTCCCAAAGCGTGAGCGGGG - Intergenic
1020528108 7:9290398-9290420 AAATTGACAAACCTTTAGCTAGG - Intergenic
1022152030 7:27618060-27618082 CAATTCACAAACCCTGTGCTTGG + Intronic
1022450313 7:30507738-30507760 GCGTTTACAAACCTTTAGCTAGG + Intronic
1023754347 7:43402129-43402151 GCATTCACCATCCTTCAGGTCGG + Intronic
1024493653 7:50016706-50016728 ACAGTCACAGACCCTGAGCTAGG - Intronic
1024700536 7:51900666-51900688 GCATTCACAAACCCTGAGCTAGG + Intergenic
1024868092 7:53926882-53926904 GCAGTGATTAACCTTGAGCTGGG + Intergenic
1026011360 7:66638919-66638941 GAAGACACAGACCTTGAGCTTGG - Exonic
1027545334 7:79520584-79520606 CCATTCAAAAAATTTGAGCTTGG + Intergenic
1027579605 7:79977310-79977332 GTGTTTACAAACCTTGAGCTAGG + Intergenic
1027590556 7:80113721-80113743 ACATTTACAATCCTTTAGCTAGG - Intergenic
1029623170 7:101702642-101702664 CCAGTCACTAACCCTGAGCTTGG - Intergenic
1031409322 7:121422425-121422447 GTGTTTACAAACCTTGAGCTAGG - Intergenic
1032173474 7:129605335-129605357 GCATTCACACACCCTGAGAGTGG + Intergenic
1033355911 7:140600245-140600267 GACTACACAAACCTTAAGCTGGG + Intronic
1033671161 7:143494569-143494591 CCATCCACAGACCTTGAGGTGGG - Intergenic
1033758514 7:144417673-144417695 GCATTCAAAATCCCTTAGCTAGG + Intergenic
1037173774 8:15923840-15923862 GCGTTTACCAACCTTGAGCAAGG - Intergenic
1038629660 8:29229636-29229658 GCATTCAAAGACCTTGACCACGG + Intronic
1039829790 8:41203933-41203955 GCATTTTCAAGCCTAGAGCTTGG + Intergenic
1043945621 8:86248676-86248698 GAACTGACAAACCTTTAGCTAGG - Intronic
1045335148 8:101195079-101195101 TCATTCACAAGCCTTGTGCTCGG + Intronic
1045790820 8:105981869-105981891 AAATTCACAAACCTTTAGCTGGG + Intergenic
1047945879 8:129879415-129879437 ACATGCACAGACCTTGAGCAGGG - Exonic
1047991338 8:130289725-130289747 GTATCCACAATCCTTTAGCTGGG + Intronic
1048445557 8:134490248-134490270 CCATTCACTCACCTTGATCTTGG - Intronic
1048576924 8:135699781-135699803 ACATCCACAAACCATTAGCTAGG - Intergenic
1051425008 9:16924240-16924262 GCGTTTACAAACCTTGAGCTAGG + Intergenic
1055925733 9:81508067-81508089 GCGTTTACAAACCTTGAGCTAGG - Intergenic
1056743843 9:89282958-89282980 GTGTTTACAAACCTTGAGCTAGG - Intergenic
1058973355 9:110102983-110103005 GCATGCAGAAACCCTGAGATGGG - Intronic
1188766281 X:34095912-34095934 GCATTTACAAACTTTTAGCTAGG + Intergenic
1189360592 X:40347694-40347716 AAATTTACAAACCTTTAGCTAGG - Intergenic
1190045751 X:47110627-47110649 GCTTTCACAAACCCTGAGCTAGG + Intergenic
1190322234 X:49186116-49186138 GCATTCCCAGACCTGGGGCTGGG - Intronic
1191706549 X:64100071-64100093 GAGTTCAAAAACCCTGAGCTTGG + Intergenic
1192011115 X:67273905-67273927 AAATTGACAAACCTTGGGCTGGG - Intergenic
1192241661 X:69335441-69335463 GAATTGACAAACCATTAGCTAGG - Intergenic
1193888512 X:87013398-87013420 GCATTTACAATCCTTTAGCTAGG + Intergenic
1194168564 X:90553549-90553571 GCATTTACAATCCTTTAGCTAGG + Intergenic
1196285905 X:113880059-113880081 AAATTCACAAACATTGGGCTAGG + Intergenic
1196761888 X:119208300-119208322 GCACTCACAAACCTTGAGCTAGG + Intergenic
1196762212 X:119210305-119210327 GCATTCACAAACTTTGAGCTAGG + Intergenic
1196762228 X:119210465-119210487 GCACTCACAAACCTTGAGCTAGG + Intergenic
1196762244 X:119210584-119210606 GCACTCACAAACCTTGAGCTAGG + Intergenic
1197078924 X:122388852-122388874 GCATTTACAATCCTTTAGCTAGG + Intergenic
1197659383 X:129153595-129153617 GACTTCAAAAACCTTCAGCTGGG + Intergenic
1199082140 X:143588882-143588904 GCATTTACAATCCTCTAGCTAGG + Intergenic
1200514806 Y:4131333-4131355 GCATTTACAATCCTTTAGCTAGG + Intergenic
1200750357 Y:6939326-6939348 GTGTTTACAAACCTTTAGCTAGG + Intronic
1200888757 Y:8299112-8299134 GTATTTACAATCCCTGAGCTAGG - Intergenic
1201499434 Y:14626785-14626807 GCATTTACAATCCTCTAGCTAGG + Intronic
1201556389 Y:15267776-15267798 GTGTTTACAAACCTTGAGCTAGG - Intergenic
1202100487 Y:21303244-21303266 GCATTTACAAACCTTGAGCTAGG + Intergenic
1202192991 Y:22263037-22263059 GCATTTACAATCCTTTAGCTAGG + Intergenic
1202242487 Y:22785844-22785866 ACATTTACAATCCTTAAGCTAGG - Intergenic
1202302348 Y:23430121-23430143 GCATTCAGAAACAATGATCTGGG + Intergenic
1202395472 Y:24419593-24419615 ACATTTACAATCCTTAAGCTAGG - Intergenic
1202475312 Y:25250499-25250521 ACATTTACAATCCTTAAGCTAGG + Intergenic
1202568463 Y:26240477-26240499 GCATTCAGAAACAATGATCTGGG - Intergenic