ID: 952058665

View in Genome Browser
Species Human (GRCh38)
Location 3:29480480-29480502
Sequence AACCAGATGAAGGTAATGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 154}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952058665 Original CRISPR AACCAGATGAAGGTAATGCA TGG Intronic
900378631 1:2372947-2372969 ACTCAGATGCAGGGAATGCAGGG - Intronic
904186847 1:28712199-28712221 AACCAGATGGAAGAGATGCATGG + Intronic
906443913 1:45876682-45876704 AACCACATAAAGGTAGTCCAAGG - Intronic
910783463 1:90967668-90967690 AACCAGTTGAAGTTAATAAAAGG - Intronic
912740850 1:112195774-112195796 AACCTGGTAAAGGTCATGCATGG + Intergenic
915531705 1:156505902-156505924 AACAAGAAAAAGGAAATGCAGGG + Intergenic
917479347 1:175397737-175397759 AATCAGAAGAAAGTAAAGCAAGG - Intronic
918575799 1:186058126-186058148 AACAAGATGAAGGTTAAGTAAGG + Intronic
918779248 1:188675243-188675265 AACCAGGTTAAGGTATTTCACGG - Intergenic
919590224 1:199493278-199493300 AACCAGATAAAGATATTACAAGG + Intergenic
920673861 1:208025343-208025365 AACCACTTGGAGGTAAAGCAGGG + Exonic
920686961 1:208116859-208116881 ACCCAGATGAATGGAATGAAAGG + Intronic
921248457 1:213272625-213272647 GATGAGATGAACGTAATGCAGGG + Exonic
924141225 1:241025773-241025795 TACCTGATGAAGGTACTGAAGGG + Intronic
924813878 1:247426199-247426221 AACATGATGAAGGTAAATCAAGG + Intronic
1064311248 10:14213619-14213641 AGCCAGAGGGAGGTAAAGCATGG + Intronic
1070018379 10:72558499-72558521 AACCAGAAGAAGCTACGGCAGGG + Intronic
1072908501 10:99478026-99478048 AACCAGATAAAGGCATTACAAGG + Intergenic
1072987202 10:100151365-100151387 AACCCAATGCAGGGAATGCAAGG + Exonic
1073969048 10:109026130-109026152 ACCAAGATGAAGGTATTGGAAGG + Intergenic
1074431561 10:113399172-113399194 AACCAGATGATGCTAATGAATGG - Intergenic
1075359132 10:121813862-121813884 AACCAGAAGAAAGTAACCCAGGG + Intronic
1077819739 11:5725370-5725392 AACCAGATGAAAGACATGCGAGG + Intronic
1078457326 11:11485448-11485470 AGCCAGATGGAAGAAATGCATGG + Intronic
1080285747 11:30608986-30609008 AACAAGAGGATTGTAATGCAGGG - Intergenic
1080978095 11:37365816-37365838 AACCAGTTGTTGGTAAAGCAGGG - Intergenic
1085957086 11:81411703-81411725 AATCAAAAGAAGGTCATGCAGGG - Intergenic
1086724362 11:90164720-90164742 AACCAGGTGAAGTTAAGGGAGGG - Intronic
1088118991 11:106345757-106345779 AAGGACATGAAGGTAAAGCATGG + Intergenic
1088237870 11:107744395-107744417 AAACAGATGAAAGGAAAGCAGGG + Intergenic
1088357450 11:108958867-108958889 AACCATCTGTAGGAAATGCAAGG - Intergenic
1089169816 11:116504226-116504248 AACCAGCTGATGGTAGTGCTGGG + Intergenic
1091333625 11:134750571-134750593 TCCCTGATGAAGGTAGTGCAAGG + Intergenic
1091967950 12:4761434-4761456 AACTTGTTTAAGGTAATGCAGGG + Intronic
1093826452 12:23696118-23696140 AACCACATGAAGGTATGTCAAGG - Intronic
1094367532 12:29699930-29699952 TACCAGATGATGGCAAGGCATGG - Intronic
1098714497 12:73812752-73812774 ACACAGATGGAGGTTATGCATGG + Intergenic
1100013035 12:89976581-89976603 AAAGAGATGAGGGTAATGAATGG + Intergenic
1101237850 12:102807350-102807372 AACCAGATGCAGGTGATTCAGGG + Intergenic
1101787131 12:107893829-107893851 AATCAGATGGAGGCACTGCAGGG - Intergenic
1102300152 12:111765898-111765920 AACCAGAGGAAGAAAAGGCATGG - Intronic
1102809851 12:115814842-115814864 AACCAGACCAAGGTAACCCAAGG + Intergenic
1105072048 12:133240332-133240354 ACCCAGAGGAAGGAACTGCAGGG - Intergenic
1107199187 13:37693294-37693316 AAGAAGATGAGGGTAATCCACGG + Intronic
1108549221 13:51526561-51526583 TACCAGATAAAAGTAAAGCAAGG + Intergenic
1109350231 13:61170647-61170669 AAGCATATGAAGGTATTACAGGG + Intergenic
1109869511 13:68315140-68315162 ATCCTGAAGAAGGCAATGCAAGG + Intergenic
1110794415 13:79620211-79620233 TACCAGTGGAAGGGAATGCATGG - Intergenic
1112039680 13:95534297-95534319 AACCATATGAAGCTACTGCCAGG + Intronic
1114039801 14:18667135-18667157 AACCCAATGAAAGTAATGGAAGG + Intergenic
1114338630 14:21719443-21719465 AACTGGATGAAGGTGAGGCAAGG + Intergenic
1122313966 14:100814932-100814954 ATCCAGGGGAAGGCAATGCACGG - Intergenic
1123422525 15:20144267-20144289 AACCAGCTCAGGGTAAGGCAGGG + Intergenic
1126383914 15:48074662-48074684 AACCAGATCAAGGGAATTCCGGG + Intergenic
1127337473 15:58003368-58003390 AACCAGATCAAGCTGATTCAAGG + Intronic
1130157420 15:81363749-81363771 AACAAAATTAAGGTAATGTAAGG - Intronic
1131622736 15:94084340-94084362 AAGCAGATGAAGGTGTGGCAGGG + Intergenic
1131994354 15:98119940-98119962 TGCCAGAGGAAGGGAATGCATGG - Intergenic
1134798970 16:17067090-17067112 AACCAGATTAAAGTGATGGAGGG + Intergenic
1137949223 16:52766857-52766879 AACCAAATGAAAGGAATGAAAGG + Intergenic
1138528721 16:57623345-57623367 AACCAGATGCAGGTTAAACATGG + Intronic
1139297447 16:65915085-65915107 AACCAGATAAAGATATTGCCAGG - Intergenic
1141070636 16:80951511-80951533 AAACAAATCAAGGTAATTCATGG + Intergenic
1144225706 17:13143271-13143293 AACAAGCTGAAGGGAATGCAGGG - Intergenic
1144417194 17:15060757-15060779 AACCAGATGAAGATAATACAAGG + Intergenic
1148656139 17:49285292-49285314 AACCTGTGGAAGGGAATGCATGG - Intergenic
1154946851 18:21170449-21170471 GAGTAGATGAAGGTAATGAAGGG - Intergenic
1157052920 18:44189751-44189773 AATCAGATGAGGGTATTGAAAGG - Intergenic
1158281496 18:55833314-55833336 GACCAAAGGAAGGTAAGGCAGGG - Intergenic
1158430712 18:57384219-57384241 AACCAGATAATGGTAATAGAAGG + Intergenic
1159438933 18:68453097-68453119 AACCATAGGAAGTTAATACAAGG + Intergenic
926843429 2:17107367-17107389 AGACAGATGAAGGTTGTGCATGG + Intergenic
928859832 2:35844282-35844304 AACCAAATGAAAATATTGCAAGG + Intergenic
930447678 2:51495927-51495949 ACCCAGAAGAAGGGAATCCATGG + Intergenic
931508698 2:62962932-62962954 AACCAGTTGAGTGTAATGGATGG - Intronic
931942808 2:67271710-67271732 AACCAGTTGGAGATAATGCTGGG + Intergenic
934460674 2:94212534-94212556 AACCAGCGCAAGGTAAAGCAGGG - Intergenic
934935880 2:98465090-98465112 AACCACAGGAAGCTAATACAAGG - Intronic
935598994 2:104902883-104902905 ATGCAGACAAAGGTAATGCAGGG + Intergenic
937123826 2:119460251-119460273 AACCAAAAGAAGCTAATGCTTGG + Intronic
939118583 2:138089315-138089337 TCCCAGAAGGAGGTAATGCAAGG - Intergenic
943828104 2:192421953-192421975 ACACAGTGGAAGGTAATGCAGGG + Intergenic
944382260 2:199124943-199124965 AACTATAGGAAGCTAATGCAAGG + Intergenic
946675646 2:222156478-222156500 ACCCAGAGGCAGGTAATTCATGG - Intergenic
947270126 2:228325480-228325502 AACCAGAGGAAGGTGGAGCAGGG + Intergenic
947655001 2:231819478-231819500 TAACAGAGGAATGTAATGCAGGG - Intergenic
947849851 2:233277285-233277307 GAACAGATGAAATTAATGCAAGG + Intronic
1170430557 20:16272851-16272873 AACCAGATGAAAGTCATTTAAGG + Intronic
1170702955 20:18720421-18720443 AATCTTATGAAGGTAATTCAGGG - Intronic
1170747959 20:19117464-19117486 AACCAAATGAAAGTAGTGTATGG + Intergenic
1173405246 20:42758852-42758874 AACCAGTACAAGGTAATGGAAGG + Intronic
1179664958 21:42904779-42904801 AAAAAGATGAAGGTTAAGCAGGG - Intronic
1181892146 22:26072779-26072801 AAACAGATGGAGGTAATGGTAGG - Intergenic
1182372009 22:29817743-29817765 AATCAGATGAAGGTGAGGAAAGG - Intronic
1185356534 22:50375572-50375594 AACCAGATGAGGGCAAGGAACGG - Intronic
951203806 3:19904209-19904231 AACCACATGAAACTAATGCATGG - Intronic
952058665 3:29480480-29480502 AACCAGATGAAGGTAATGCATGG + Intronic
953014762 3:39063179-39063201 AATCAGCACAAGGTAATGCAGGG + Exonic
955040517 3:55313468-55313490 AACAGAATGAAGGTGATGCAGGG - Intergenic
956001921 3:64738796-64738818 TTCCTCATGAAGGTAATGCAAGG - Intergenic
956178020 3:66492451-66492473 AACACGATGAACGTAATGCAGGG - Intronic
958435240 3:94088178-94088200 AAGAAGATGAACCTAATGCAGGG - Intronic
959109086 3:102100232-102100254 AAATAAATGAAGCTAATGCATGG - Intronic
961039287 3:123665943-123665965 AACCAGATGAGGGACATGGATGG + Intronic
963383471 3:144560365-144560387 AACCAGTTGAAATTACTGCACGG + Intergenic
972064277 4:34920494-34920516 AACTAGATGAAAGAACTGCATGG - Intergenic
973022000 4:45215043-45215065 TACCATATGTAGGAAATGCATGG - Intergenic
973716180 4:53678693-53678715 AACCTCAGGAAGGTAATCCAAGG - Intronic
975887777 4:78985611-78985633 AACGAGAGGAAGATAAAGCAGGG - Intergenic
978758646 4:112331146-112331168 ACAAAGATGAAGGTTATGCATGG - Intronic
978831387 4:113089534-113089556 AAGCAGATGAAGGCCAGGCATGG + Intronic
979517594 4:121628470-121628492 AACCAGGTAAGAGTAATGCAAGG - Intergenic
983604943 4:169572704-169572726 AACCAGAAGAATGTAATACCAGG + Intronic
984205559 4:176783776-176783798 AAACAGGTGAAGGAAATGCAGGG - Intronic
988677553 5:33448378-33448400 AACCAAATTGAGGTAATGCCGGG + Intronic
989239618 5:39188866-39188888 CACCAGATGATTCTAATGCAAGG - Intronic
989447364 5:41546015-41546037 AGAGAGATGAAGGTAATGCAGGG + Intergenic
989806956 5:45620831-45620853 AACCAAATGAAGGTACTTTAAGG + Intronic
993121291 5:83777591-83777613 AAACTGATGAAAGAAATGCATGG - Intergenic
993852669 5:93030808-93030830 AAACAGATGAAGGAGATGGAAGG - Intergenic
994603459 5:101937494-101937516 AAACAGATGCTGGTAATGCTTGG - Intergenic
1000336954 5:160248623-160248645 AAAAAGATGGAGGTAGTGCAGGG - Intergenic
1004018309 6:11752544-11752566 AACCAGATGGGGGTGATTCATGG + Intronic
1004828299 6:19448537-19448559 TAACAGAGAAAGGTAATGCAGGG + Intergenic
1006027424 6:31156448-31156470 CACCAGCTGATGGTAAAGCATGG - Intronic
1008360803 6:50615723-50615745 AACCAGCTGAAAGTAAAGAATGG + Intergenic
1008989646 6:57587852-57587874 AGCCAAATGGAAGTAATGCACGG + Intronic
1010742370 6:79523997-79524019 AACCACATGTTGGTTATGCATGG + Intronic
1011895960 6:92225550-92225572 AACCAGATTAAAGTTTTGCAAGG - Intergenic
1012563282 6:100614213-100614235 ATGCAGATAAAGGTAATGAAAGG + Intronic
1015035291 6:128645938-128645960 GGCCAGATGAAGATAATTCAGGG + Intergenic
1015169550 6:130236886-130236908 AACCATATGAAGTTGATACAAGG - Intronic
1015514369 6:134069869-134069891 AAGCAAATGGAGGTAAGGCAAGG + Intergenic
1019009717 6:168834308-168834330 AACCAGATGTAGGAACTGCATGG + Intergenic
1019167185 6:170105787-170105809 AACCAGATAAAAGTAACACATGG - Intergenic
1019215049 6:170438112-170438134 AACCAAATGCAGGGAATACAAGG + Intergenic
1020269140 7:6582171-6582193 GGGCAGAAGAAGGTAATGCAAGG - Exonic
1020851717 7:13361814-13361836 AACAAGATGAAGGGGGTGCAAGG - Intergenic
1023165482 7:37339169-37339191 CACCAGATGAATCTAATCCAAGG - Intronic
1023371661 7:39518002-39518024 AGCAAAATGAATGTAATGCAAGG - Intergenic
1024863684 7:53877508-53877530 AAGCAGATGAAGGAAATAAAAGG - Intergenic
1025606364 7:63042729-63042751 AAACAGATGCAGGGCATGCAGGG + Intergenic
1027946799 7:84757518-84757540 AACCAGATGCAGCTGAGGCAAGG + Intergenic
1028528244 7:91809215-91809237 GACCAGATGTAGGACATGCAAGG - Intronic
1031315351 7:120250973-120250995 AACCAGATAAAGCTATTACAAGG + Intergenic
1032494849 7:132353670-132353692 CAGCAGAGGAAGCTAATGCAGGG - Intronic
1033164385 7:139027058-139027080 AACCAGATGAAGACAATGACAGG + Intronic
1035304949 7:157926081-157926103 AGACAGAGGGAGGTAATGCATGG - Intronic
1035515142 8:226419-226441 AACAAGAAAAAGGAAATGCATGG + Intergenic
1038980348 8:32752578-32752600 AACCAGAGGGAGGAAATGCTTGG - Intronic
1040344480 8:46476004-46476026 AACCTGATGAATGTAAAGAAAGG + Intergenic
1041610623 8:59843286-59843308 AATCAGTTGAATGTAATACATGG - Intergenic
1044781157 8:95744699-95744721 AACCAGATCAAGGAAATGCCAGG + Intergenic
1048471014 8:134704140-134704162 AACCAGGCTCAGGTAATGCAGGG - Intronic
1050607992 9:7321156-7321178 AAACAGCTGAAGATGATGCAGGG - Intergenic
1056267202 9:84909660-84909682 AATTAGATGAGGGAAATGCAGGG - Intronic
1056490418 9:87101625-87101647 AACCAAAAGCAGGTAATTCACGG + Intergenic
1056976418 9:91259405-91259427 AACCTGATCAAGGAAATGAAAGG - Intronic
1186212512 X:7264402-7264424 AGCCAGATGCAGGCATTGCAGGG + Intronic
1187584193 X:20641630-20641652 AACCAGATGAAAGTGAGGGATGG - Intergenic
1191837233 X:65477285-65477307 CACCAAATGATGGTCATGCAAGG - Intronic
1192267037 X:69545996-69546018 AAACAGATGATGGTAGTGGAAGG + Intergenic
1193907992 X:87265634-87265656 TCCCAGAGGAAGGTAATACATGG + Intergenic
1195541634 X:106068943-106068965 AACCAGACAAAGGAACTGCAGGG + Intergenic
1195684210 X:107570896-107570918 AGCCAGAAGAAGGTACAGCAGGG - Intronic