ID: 952064094

View in Genome Browser
Species Human (GRCh38)
Location 3:29546999-29547021
Sequence CAGGGTCCCACTGGTCACCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 747
Summary {0: 1, 1: 0, 2: 26, 3: 121, 4: 599}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952064094 Original CRISPR CAGGGTCCCACTGGTCACCC AGG Intronic
900112433 1:1014148-1014170 CAGGGTCCCCCTTGCCAGCCAGG + Exonic
900206747 1:1434909-1434931 GAGGGTCCCACTGGTGAGACAGG - Intronic
900291008 1:1923597-1923619 CAGGGCCCCACGGGGCCCCCAGG - Intronic
900567212 1:3339398-3339420 TAGGGTCCTACTGACCACCCAGG - Intronic
901456865 1:9368034-9368056 CATGGCCCCGCTGGGCACCCTGG - Exonic
901845606 1:11980337-11980359 CAGGGTCCACCAGCTCACCCGGG + Exonic
902216802 1:14939463-14939485 CAGGGTCTCACTTGTTGCCCAGG + Intronic
902429833 1:16354328-16354350 CAGGGTCTCACTCTTCGCCCAGG + Intronic
902546445 1:17193481-17193503 GAGAGTCCCACAGGTCATCCAGG - Intergenic
902573558 1:17362325-17362347 CAGGGTCTTACTCTTCACCCAGG - Intronic
902898243 1:19494566-19494588 CAGAGTCTCTGTGGTCACCCAGG - Intergenic
903291583 1:22317586-22317608 CAGGGTCTCATCTGTCACCCAGG + Intergenic
903461149 1:23521807-23521829 GAGGGTACCACTGGCCGCCCAGG + Intronic
904152249 1:28451667-28451689 CAGGGTCTCACTTGTTGCCCAGG + Intronic
904290955 1:29485607-29485629 AAGGGCCCCAATGGGCACCCAGG - Intergenic
904452945 1:30628164-30628186 GAGGGTCCCAGGGGTCACCCAGG + Intergenic
904599364 1:31665215-31665237 CAGGGTCCCCCTGGATTCCCAGG - Exonic
905169192 1:36099397-36099419 CGGGGTCCCCCTGGCCCCCCTGG - Exonic
905428104 1:37900278-37900300 CAGAGTCTCTCTTGTCACCCAGG + Intronic
905731618 1:40302683-40302705 CAGGGCCCCCATGGGCACCCTGG - Exonic
905863011 1:41362831-41362853 CATGGTCACACTCCTCACCCTGG - Intronic
906244490 1:44263379-44263401 CTGGGTCCAACTGGCCACACAGG + Intronic
906312537 1:44764199-44764221 CAGAGTCTCACTCGTCACCCAGG + Intronic
907025572 1:51114695-51114717 CAGAGTCTCGCTTGTCACCCAGG - Intronic
907098156 1:51800864-51800886 CAGGATATCACTGGTCACCCAGG + Intronic
907807103 1:57831732-57831754 CAGGGTCTCACTTGTTGCCCAGG + Intronic
908240779 1:62187431-62187453 CAGAGTCTCACTCCTCACCCAGG + Intergenic
908582373 1:65529493-65529515 CAGAGTCTCACTCGTCTCCCAGG - Intronic
909760260 1:79277529-79277551 CAGAGTCTCACTTATCACCCAGG + Intergenic
909955827 1:81777735-81777757 CAGAGTCTCACTTGTCACCCAGG - Intronic
910415269 1:86990959-86990981 CAGGGTCCAGCTGGGCACTCAGG - Intronic
910675073 1:89808281-89808303 AAAGGTCTCACAGGTCACCCAGG + Intronic
911076016 1:93875987-93876009 CAGGGTCTCACTGTTGGCCCAGG + Intronic
911591702 1:99755226-99755248 CAGGGTCTCACTTGTTGCCCAGG - Intronic
911864273 1:102996023-102996045 CAGGGTCCCCCTGGTCCACAAGG - Exonic
911864916 1:103006278-103006300 CAGGGTCCCCCTGGTCCAACGGG - Exonic
911865623 1:103017836-103017858 CAAGGCCCCACTGGACCCCCTGG - Exonic
912365178 1:109127590-109127612 CAGCGTCCTACTCTTCACCCAGG + Intronic
912377694 1:109225081-109225103 CAGGGTTTCACTGGAAACCCAGG - Intronic
912460895 1:109830537-109830559 CAGGGTCTCACTCGTTGCCCAGG + Intergenic
912773177 1:112484325-112484347 GAGGGTCTCACTTGTCACCCAGG + Intronic
912977478 1:114343658-114343680 CAGGGTCTCACTCTTCACTCAGG + Intergenic
913649658 1:120900366-120900388 CAGAGTCCAGCTTGTCACCCAGG + Intergenic
913707243 1:121437928-121437950 CATTGCCCCACTGGTCACTCAGG - Intergenic
914077027 1:144363164-144363186 CAGAGTCCAGCTTGTCACCCAGG - Intergenic
914102151 1:144603341-144603363 CAGAGTCCAGCTTGTCACCCAGG + Intergenic
914171477 1:145228731-145228753 CAGAGTCCAGCTTGTCACCCAGG - Intergenic
914243565 1:145869499-145869521 CAGGGTCTCACCTGCCACCCAGG + Intronic
914296749 1:146333853-146333875 CAGAGTCCAGCTTGTCACCCAGG - Intergenic
914462071 1:147894168-147894190 CAGAGTCTCACTTGTCACCCAGG - Intergenic
914526586 1:148472697-148472719 CAGAGTCCAGCTTGTCACCCAGG - Intergenic
914639816 1:149594425-149594447 CAGAGTCCAGCTTGTCACCCAGG + Intergenic
914721156 1:150290131-150290153 CAGAGTCTCACATGTCACCCAGG + Intergenic
914895410 1:151667221-151667243 CAGGGTCTCACTTGTTGCCCAGG - Intronic
915181267 1:154062611-154062633 CAGGGTCTCACTCTTCACCCAGG + Intronic
915234953 1:154473776-154473798 CAGGGTCTCACTCGTCACCCAGG - Intronic
915270871 1:154752501-154752523 CAGGGTCTCACTGCTGGCCCGGG - Intronic
915286046 1:154853013-154853035 CAGGGTTTCACATGTCACCCAGG + Intronic
915375959 1:155395805-155395827 CAGGGTCTCACTTGTTACCCAGG - Intronic
915920366 1:159971787-159971809 CAGGGTCACAGTTGACACCCAGG + Intergenic
916017513 1:160763204-160763226 CAGGGACCCACTGGACCCACTGG + Intergenic
916200252 1:162264530-162264552 CAGAGTCTCACTGGTCACCCAGG + Intronic
916753084 1:167741353-167741375 CAAGGTCTCACTTGTCACCCAGG + Intronic
917003678 1:170388108-170388130 CAGGGTCTCACTCTACACCCAGG - Intergenic
917319680 1:173766614-173766636 CAGGGTCTCACTTTGCACCCAGG - Intronic
917534757 1:175866207-175866229 CAGCGTACAACTGGTCACTCAGG + Intergenic
918444182 1:184600190-184600212 CGAGGTCTCACTTGTCACCCAGG + Intronic
918597952 1:186315139-186315161 CAGGATCTCACCGGTCTCCCTGG - Intronic
919679174 1:200417468-200417490 CAGAGTCTCACTTGTCACCCAGG + Intergenic
919901658 1:202048306-202048328 CAGGGTTTCACCTGTCACCCAGG + Intergenic
920102748 1:203528043-203528065 TAGGGTCTCCCTTGTCACCCAGG - Intergenic
920173723 1:204087348-204087370 CAGGGTCCAGCTGGTGCCCCTGG - Intronic
920254435 1:204644821-204644843 GAGGGTCCCACTGCTAGCCCTGG - Intronic
921229925 1:213059537-213059559 CAGAGTCTCACTTGTCATCCAGG + Intronic
921304209 1:213779677-213779699 CATGGTCCAAATGGTCACACTGG - Intergenic
922843058 1:228660126-228660148 CAGGGTCTCATCTGTCACCCAGG - Intergenic
922923452 1:229328324-229328346 CAGGGTCTCACTTGTTGCCCAGG + Intronic
922928042 1:229367042-229367064 CAGGGTCTCCCTTTTCACCCAGG + Intergenic
923728415 1:236527759-236527781 TAGTTTCCCTCTGGTCACCCAGG + Intronic
923835783 1:237609393-237609415 CAGAGTCTCACTTGTCACCCAGG + Intronic
924471385 1:244345694-244345716 CAGGGTCTCACTTGTCACTCAGG - Intergenic
924584185 1:245347336-245347358 CAGGGTCTTACCTGTCACCCAGG + Intronic
1063236439 10:4121581-4121603 CAGGGTTGCACTGGTCTTCCAGG + Intergenic
1063462122 10:6221615-6221637 CGGGGACCCAGTGGTCACTCAGG - Intronic
1064044108 10:11995755-11995777 CAGAGTCTCACTTGTCGCCCAGG - Intronic
1064229436 10:13517088-13517110 CAGGATCTCACTTGTCGCCCAGG + Intronic
1065002309 10:21348191-21348213 CAGAGTCTCACTCTTCACCCAGG + Intergenic
1065040685 10:21692146-21692168 CAGGGTCTCATCTGTCACCCAGG - Intronic
1067133353 10:43586173-43586195 CAGGGGCCCACTTGGCCCCCAGG - Intergenic
1068190829 10:53650655-53650677 TAGGGTCTCACTCGTCACCCAGG + Intergenic
1068978891 10:63039837-63039859 CAGAGTCTCACGTGTCACCCAGG - Intergenic
1069436505 10:68388916-68388938 CAGGGTCTCATCTGTCACCCAGG + Intronic
1069481288 10:68784573-68784595 TAGGGTCTCACTTTTCACCCAGG + Intronic
1069626657 10:69872181-69872203 CAGGGTCCCACTGGAAGACCCGG + Exonic
1069630506 10:69894549-69894571 CAGGGTCTGACGGGTCCCCCAGG + Exonic
1069672950 10:70225241-70225263 CAGAGTCTCACCTGTCACCCAGG + Intronic
1069912864 10:71770555-71770577 CAGGGTCAGTCTGGTCTCCCAGG - Intronic
1070463821 10:76698157-76698179 CAGCCACCCACTGGGCACCCTGG + Intergenic
1070607752 10:77911152-77911174 CAGGGTCTTACTGTCCACCCAGG + Intronic
1070761408 10:79026606-79026628 CAGGGTCCAGCTCCTCACCCAGG - Intergenic
1070828528 10:79404969-79404991 CAGGGGCACCCTGGTCTCCCTGG + Intronic
1071220598 10:83460371-83460393 CAGAGTCTCACCTGTCACCCAGG - Intergenic
1071486479 10:86105841-86105863 CTGGGCACCACAGGTCACCCAGG + Intronic
1071862265 10:89686382-89686404 CAGAGTCTTACTTGTCACCCAGG + Intergenic
1072244517 10:93530897-93530919 CAGGGTCCCCTCTGTCACCCAGG + Intergenic
1072453582 10:95558261-95558283 CAGGGTCTCACCTGTCACCCAGG - Intronic
1072999258 10:100274223-100274245 CAGGGTCTCTATTGTCACCCAGG - Intronic
1073210553 10:101798434-101798456 CAGTTTCCCTCTCGTCACCCAGG + Intronic
1073244853 10:102082604-102082626 CAGGATCTCACTTGTCGCCCAGG + Intergenic
1073263557 10:102208837-102208859 CCGGGTCACACTGGAAACCCTGG + Intergenic
1073380480 10:103074260-103074282 CAGTCTCCCTCTCGTCACCCAGG - Intronic
1073466134 10:103695481-103695503 CAGAGTCTCACTTGTCACTCAGG - Intronic
1073476765 10:103758889-103758911 CTGGGTCCCACAGGTGACCTGGG - Intronic
1074066401 10:110018500-110018522 CAAAGTCTCACTTGTCACCCAGG - Intronic
1074569482 10:114611443-114611465 CAGAGTCTCACCTGTCACCCAGG - Intronic
1075643260 10:124080501-124080523 CAGGGTCCCAGTGCTCACAGAGG - Intronic
1075650927 10:124128096-124128118 CAGGGTCCCTCAGGTCTCTCAGG - Intergenic
1076196767 10:128524199-128524221 CAGGGTCCAACTGGTCAACCAGG + Intergenic
1076521162 10:131082279-131082301 CAGGCTCCAGCTGGCCACCCTGG - Intergenic
1077231382 11:1459520-1459542 GAGGGTCCCGCTGGTCCCACTGG + Intronic
1077253581 11:1571319-1571341 CAGGGGCCGGCTGGGCACCCCGG + Intronic
1077431425 11:2517697-2517719 CATGGTCCCACTGGCCAAACCGG - Intronic
1077525145 11:3059708-3059730 CAGGGTCTCACTCTGCACCCAGG - Intergenic
1077656420 11:4023301-4023323 CAGAGTCTCGCTCGTCACCCAGG - Intronic
1077730780 11:4726988-4727010 CAGGGTCCCGGTCTTCACCCAGG - Intronic
1077868140 11:6239911-6239933 CAGCATCCCAGTGCTCACCCCGG + Intronic
1078023015 11:7671133-7671155 CATGGTCCCTCTGGGCACCAGGG + Intronic
1078236534 11:9490313-9490335 CAGGGTCTCATTTGTTACCCAGG + Intronic
1078497503 11:11834227-11834249 CAGGGTCTCTCTCGTCACCCAGG + Intergenic
1079264853 11:18921263-18921285 CAGGGGACCACTTGTCTCCCTGG - Intergenic
1079267028 11:18943410-18943432 CAGGGGACCACTTGTCTCCCTGG - Intergenic
1080740322 11:35057858-35057880 CAGGGTCTCCCTCTTCACCCAGG - Intergenic
1080759391 11:35233454-35233476 CAGGGTCTCACTCTTCACCCAGG - Intergenic
1081484663 11:43518384-43518406 CAGGGTCTCACTTGTCATCCAGG - Intergenic
1081687584 11:45053573-45053595 CAAGGTCCCACAGGTAACCAGGG - Intergenic
1081959447 11:47123924-47123946 CAGAGTCACTCTTGTCACCCAGG - Intronic
1082225371 11:49699915-49699937 CATGGGCCCACTGGTCATTCAGG + Intergenic
1082268069 11:50141365-50141387 CAGAGTCTCACTTGTCGCCCAGG + Intergenic
1083211324 11:61188913-61188935 CAGGGTCTCACTTGTTGCCCAGG + Intergenic
1083571939 11:63765751-63765773 CTGTGCCCCACTGGCCACCCAGG + Intronic
1083620310 11:64046092-64046114 CAAGGTCACACAGGTCACACAGG + Intronic
1084003279 11:66310245-66310267 CAGAGTTTCACTCGTCACCCAGG + Intergenic
1084042910 11:66552829-66552851 CAGAGTCTCTCTTGTCACCCAGG - Intronic
1084208416 11:67609426-67609448 CAGGGGCCCACAGGTCAGACAGG - Intronic
1084284841 11:68124315-68124337 CAGGGTCTCACTTGTTGCCCAGG - Intergenic
1084299772 11:68240634-68240656 CAGGGTCTCACTTGTTGCCCAGG + Intergenic
1084626490 11:70311867-70311889 CAGGGTTCACCTTGTCACCCAGG + Intronic
1084859007 11:72006039-72006061 AGGGGCCCCACTGGACACCCCGG + Exonic
1085001598 11:73041950-73041972 CAGAGTCTCACTCGTCACCCAGG + Intronic
1085053546 11:73391751-73391773 CAGGGTCTCACTTGTTGCCCAGG - Intronic
1085405072 11:76256842-76256864 CAGGGTCCCACAGGCCCCACAGG + Intergenic
1086036241 11:82417985-82418007 CAGGGTCTCACTGTTTGCCCAGG - Intergenic
1086297603 11:85388196-85388218 CTGGGTCACACGGGTCACCAGGG - Intronic
1086623720 11:88919790-88919812 CATGGGCCCACTGGTCATTCAGG - Intronic
1088279214 11:108120164-108120186 CAGTCTCGCACTTGTCACCCAGG - Intergenic
1088956069 11:114615812-114615834 CAGGGTAACAGTGGTTACCCAGG - Intergenic
1090026743 11:123174055-123174077 CAGGGTCCCACCTGTTGCCCAGG - Intronic
1090399590 11:126440561-126440583 CAGCGTCCCATTAGGCACCCGGG + Intronic
1090732298 11:129582387-129582409 CAAAGTCTCACTTGTCACCCAGG + Intergenic
1090808025 11:130214964-130214986 CAGGGTCTCACTGTTTGCCCAGG - Intergenic
1092110322 12:5956614-5956636 CAGGGTCTCATTCGTCACCCAGG - Intronic
1092220532 12:6709965-6709987 CAGAGTTTCACTCGTCACCCAGG - Intergenic
1092644870 12:10559453-10559475 CAGGGTCCCCCTGGGCCTCCTGG - Intergenic
1092690702 12:11107033-11107055 CAGGGTCTTACTCGTCACCCAGG + Intronic
1093447047 12:19272545-19272567 CGGGGTCTCACTGGTCACCTAGG - Intronic
1094541553 12:31367032-31367054 CAGAGTCTCACTTGTCGCCCAGG - Intergenic
1094569267 12:31627494-31627516 CAGTCTCCCTCTTGTCACCCAGG - Intergenic
1094852938 12:34390356-34390378 CAGGGACCCACAGGTCCCCTGGG - Intergenic
1095463524 12:42466900-42466922 CAGGGTCTCACTTGTAGCCCAGG + Intronic
1095860509 12:46911702-46911724 CAGTGACTCACTGGTCACTCAGG - Intergenic
1095982889 12:47982873-47982895 CAGGGTCCCCGTGGCCTCCCCGG - Exonic
1095983495 12:47985568-47985590 AAGGGTCTCACTGGCCGCCCTGG - Exonic
1096066098 12:48742104-48742126 CAGGGTCTCACTTGTTGCCCAGG + Intergenic
1096110455 12:49026164-49026186 CAAGGGCCCACTGCTCACCCTGG + Exonic
1096276023 12:50208888-50208910 CAGGGTCTTACTCATCACCCAGG - Intronic
1096295935 12:50384090-50384112 CAGAGTCTCACTTGTCGCCCAGG - Intronic
1096342444 12:50812797-50812819 CAGGGTCTCACTTGTCACCCAGG - Intronic
1096389287 12:51217108-51217130 CCGGGTCCCACCGGTCGTCCCGG + Intronic
1096391060 12:51229436-51229458 CAGGGTCTCACTTGTCACCCAGG + Intergenic
1097432230 12:59524554-59524576 CAGGGTCTTGCTCGTCACCCTGG + Intergenic
1098258338 12:68641035-68641057 CAGGGTCTCACTTGTCACCCAGG + Intronic
1098480638 12:70955645-70955667 CAGGGTCTCACTTGTTGCCCAGG + Intergenic
1098749688 12:74278307-74278329 CAGGGACCCACTGGACCCACCGG - Intergenic
1099133073 12:78861223-78861245 CAGTCTCGCACTTGTCACCCTGG + Intergenic
1099154634 12:79158869-79158891 CAAGGTTTCACTTGTCACCCAGG - Intronic
1099425732 12:82520738-82520760 CAGGGTCTCACTTGTTGCCCAGG - Intergenic
1100883316 12:99041973-99041995 CAGGGTCTCACTTGTCACCCAGG - Intronic
1101650802 12:106675403-106675425 CAGAGTCTCACTCGTCACCCAGG - Intronic
1102115291 12:110398218-110398240 CAGAGTTTCACTTGTCACCCAGG - Intronic
1102147295 12:110663942-110663964 GAGGATCTCACTTGTCACCCAGG + Intronic
1102267203 12:111496629-111496651 CATGGACCCACTGGTCATTCAGG - Intronic
1102332973 12:112051237-112051259 CAGAGTCTCTCTCGTCACCCAGG + Intronic
1102490526 12:113287488-113287510 GTGGGTCCCACTGGTTTCCCAGG + Intronic
1102814711 12:115855538-115855560 CAGGGTCTCGCTCTTCACCCAGG - Intergenic
1102955243 12:117054649-117054671 CAGGGTCCCACTGGAAACTGGGG - Intronic
1103105968 12:118225220-118225242 CAGTCTCGCACTTGTCACCCAGG - Intronic
1103534033 12:121622394-121622416 CAGGGTCTCAATAGTCACCCAGG - Intergenic
1103639349 12:122336992-122337014 CAGGGTCTCCCCTGTCACCCAGG + Intronic
1103972255 12:124679555-124679577 CAGACTCACAGTGGTCACCCAGG + Intergenic
1104643122 12:130479937-130479959 CAGGGTCCCAGTGGTGACTCTGG - Intronic
1104672196 12:130688574-130688596 CAGAGTCCTAAGGGTCACCCGGG - Intronic
1105028193 12:132863782-132863804 CAGGGTCTCACTCTTCACCCAGG + Intronic
1105307025 13:19176092-19176114 CAGAATCCCACCTGTCACCCAGG - Intronic
1105391300 13:19981244-19981266 CAGGGTCTCACTGGCAACCTAGG - Intronic
1105393569 13:20006205-20006227 CAGGGTCTCACTCATTACCCAGG - Intronic
1105563717 13:21521800-21521822 CAGGGTCTCACCTGTCACCCAGG + Intronic
1106167492 13:27261895-27261917 CAGTGTCTCCCTCGTCACCCAGG + Intergenic
1106413236 13:29525305-29525327 CAGGGTCCCACTGGCTGGCCTGG + Intronic
1107923324 13:45232607-45232629 CAGGGTCTTGCTCGTCACCCAGG - Intronic
1108058115 13:46505361-46505383 TACGGTACCACTGGGCACCCAGG + Intergenic
1110860201 13:80339445-80339467 CAGGGTCCCACTGCTCACTCCGG + Exonic
1110974438 13:81811550-81811572 CATTGACCCACTGGTCACTCAGG - Intergenic
1112346930 13:98597752-98597774 CAGAGTCTCACCTGTCACCCAGG + Intergenic
1112370752 13:98791424-98791446 CAGAGTCTCACTTGTCACCTAGG + Intergenic
1113440298 13:110323252-110323274 CAGAGGCCCACTGGTGACTCTGG + Intronic
1114756123 14:25262257-25262279 CAGAGTCTCACTGGAGACCCAGG + Intergenic
1115849357 14:37577195-37577217 CAGGGTCTCTCTTGTCACCCAGG + Intergenic
1115995688 14:39193653-39193675 CAGAGTCTCACTCGTCGCCCAGG + Intergenic
1116370315 14:44122013-44122035 CAGAGTCCCACTGGTCCCTGTGG + Intergenic
1116446494 14:45017853-45017875 CAGAGTTTCACTTGTCACCCAGG - Intronic
1116698411 14:48204462-48204484 CAGAGTCTCGCTTGTCACCCAGG - Intergenic
1117543813 14:56773964-56773986 CAGGATCTCACTTGTCACCCAGG - Intergenic
1117650527 14:57900193-57900215 CAAGGCCCCACTGGGGACCCAGG + Intronic
1118166247 14:63339380-63339402 CAGAGTTTCACTCGTCACCCAGG - Intergenic
1118228401 14:63925294-63925316 CAGGGTCTCACTCGTCACCCAGG - Intronic
1118245754 14:64108898-64108920 CATGGTCTCACTCTTCACCCAGG + Intronic
1118267470 14:64308801-64308823 CAGAGTCTCACCTGTCACCCAGG + Intronic
1118500511 14:66358080-66358102 CAGAGTCTCACTCTTCACCCAGG + Intergenic
1118567383 14:67156944-67156966 CAGAGTCTCACTTGTCACCCAGG - Intronic
1118617258 14:67582621-67582643 CAGGGTTTCACTGGTCAGGCTGG - Intronic
1118626491 14:67664107-67664129 CAGAGTCTCACTGGTCACCTAGG + Intronic
1118828384 14:69405558-69405580 CAGGGTCTCACTTGTTGCCCAGG - Intronic
1118951546 14:70440346-70440368 CAGGGGCCCACTCGGCCCCCAGG - Intergenic
1119041878 14:71281882-71281904 CAGGGTCTCATTTGTCACCCAGG - Intergenic
1119409769 14:74423232-74423254 CAGGGCATCTCTGGTCACCCAGG - Intronic
1119516315 14:75251432-75251454 CAGGCTCTCACTGGCCACTCTGG - Intronic
1119635757 14:76271920-76271942 GAGGGGGCCACTGGTCACTCAGG + Intergenic
1120825423 14:88950524-88950546 CAAGATCTCACTGGTCACCCAGG - Intergenic
1121118597 14:91361102-91361124 CAGGGTTTTACTCGTCACCCAGG - Intronic
1121673991 14:95737428-95737450 CAGAGTCTCACTTGTCGCCCAGG - Intergenic
1121961149 14:98261395-98261417 CAGGGTCACACAGGTCACCAGGG - Intergenic
1122130077 14:99599847-99599869 CAGGGTCTCTCTGGTCACCCAGG - Intronic
1122728912 14:103780459-103780481 CAGGGTTTCACTTGTTACCCAGG - Intronic
1123811099 15:23926904-23926926 CAAGGTCTCACCTGTCACCCAGG - Intergenic
1124220207 15:27844533-27844555 CAGAGTCTCACTTGTCACCCAGG + Intronic
1124360891 15:29035919-29035941 CAGGGTGCCAGCTGTCACCCCGG + Intronic
1125442970 15:39722903-39722925 CAAGGTCTCGCTTGTCACCCAGG - Intronic
1125582048 15:40792918-40792940 GATGGTCTCACTTGTCACCCAGG + Intronic
1125626113 15:41110462-41110484 CAGGGTCTCGCTTGTCACCCAGG + Intronic
1125668399 15:41450925-41450947 CAGGGTCTCGTTTGTCACCCAGG - Intronic
1125712072 15:41795137-41795159 CAGGGTTTCACTTGTCACCCAGG - Intronic
1126584438 15:50269179-50269201 CAGGGTCTCACTCGTCAACCAGG + Intergenic
1126993676 15:54414619-54414641 CAGAGTCTCACTCTTCACCCAGG - Intronic
1128361936 15:66968413-66968435 CAGAGTCACACCTGTCACCCAGG + Intergenic
1128651755 15:69420711-69420733 CAGGGTCTCACTTGTTGCCCAGG + Intronic
1129298094 15:74610783-74610805 CTGGGTCCCAAGGGTCCCCCAGG + Intronic
1129298161 15:74611072-74611094 CAGGGTCCCTGTGGCCCCCCAGG - Intronic
1129365991 15:75055145-75055167 CAGAGTCTCACTCCTCACCCAGG - Intronic
1129501972 15:76048126-76048148 CAGGGTTTCTCTTGTCACCCAGG - Intronic
1129855324 15:78820085-78820107 CAGAGTCTCACTTGTCACCCAGG - Intronic
1130428626 15:83824067-83824089 CAGGGTCTCATCTGTCACCCAGG + Intronic
1130560002 15:84950677-84950699 CAGAGTCACTCTTGTCACCCAGG - Intergenic
1130642804 15:85694981-85695003 CAGGGTCTCACTAGTTGCCCAGG + Intronic
1130913685 15:88288855-88288877 CAGGGAGCCACTGCTCTCCCGGG - Intergenic
1131034022 15:89209417-89209439 CAGGGTCTCACTTGTCACCCAGG - Intergenic
1131255574 15:90859801-90859823 CAGGTCCCCACAGGACACCCCGG + Intergenic
1131256313 15:90864974-90864996 CAGTGTCACTCTTGTCACCCAGG - Intergenic
1132109658 15:99093356-99093378 CAGGGTCTTGCTTGTCACCCAGG + Intergenic
1132604732 16:788953-788975 CGGGGTCCCCCTGTTCACCGCGG + Exonic
1132771262 16:1564773-1564795 CAGGGTCCCACTCTGCAGCCTGG - Intronic
1133227356 16:4348082-4348104 CAAGGACACTCTGGTCACCCAGG + Intronic
1134148343 16:11785643-11785665 CAGAGTCTCACTTGTCACGCAGG + Intronic
1134521886 16:14922560-14922582 CAGGGTATCATTGGTCTCCCAGG - Intronic
1134536540 16:15030975-15030997 CAGGGTCTCATTTGTCACCCTGG + Intronic
1134589518 16:15441242-15441264 CAGGGTCTCGCTTGTCACCCAGG + Intronic
1134709555 16:16321211-16321233 CAGGGTATCATTGGTCTCCCAGG - Intergenic
1134716769 16:16361240-16361262 CAGGGTATCATTGGTCTCCCAGG - Intergenic
1134817682 16:17219557-17219579 CAGGGTCTCTCTGGTCTTCCAGG - Intronic
1134950047 16:18347434-18347456 CAGGGTATCATTGGTCTCCCAGG + Intergenic
1134957983 16:18390919-18390941 CAGGGTATCATTGGTCTCCCAGG + Intergenic
1135485985 16:22865023-22865045 TAGGGTCTTACTCGTCACCCAGG - Intronic
1136011907 16:27368891-27368913 CAGAGTCCCACTTGTTGCCCAGG - Intergenic
1136268067 16:29132371-29132393 CAGGATCCCCCAGGACACCCTGG + Intergenic
1136377891 16:29876388-29876410 CAGGTTCCCACTGGGCTCCCCGG - Intronic
1136386903 16:29933289-29933311 CAGGGTCTCACATGTTACCCAGG + Intergenic
1136407904 16:30059555-30059577 CAGGGTCTCTCTTGTCACCCAGG + Intronic
1136559130 16:31028343-31028365 CTGGGTCCCACTGTGCACCAGGG - Intergenic
1137297329 16:47107799-47107821 CAGTCTCACTCTGGTCACCCAGG + Intronic
1137348164 16:47684298-47684320 CACGGTCTTACTTGTCACCCAGG - Intronic
1137992160 16:53169182-53169204 CAGGGTCTCATCTGTCACCCAGG - Intronic
1138059083 16:53870180-53870202 CAGGGTCTCACTTGTCATCCAGG - Intronic
1138111915 16:54330700-54330722 CAGGGTCCCTGTGGCTACCCCGG + Intergenic
1138371872 16:56533459-56533481 CAGGGTCTCATCTGTCACCCAGG - Intergenic
1138969906 16:62131804-62131826 CATGGTGCCCCTGGCCACCCTGG + Intergenic
1139565223 16:67770925-67770947 CAGGGTCTCGCTTTTCACCCAGG - Intronic
1139809688 16:69603724-69603746 TAGGGTCTGACTTGTCACCCAGG - Intronic
1139841343 16:69883273-69883295 CACGGTCACCCTGGTCAACCAGG - Intronic
1140171680 16:72611196-72611218 CAAGGTCTCACTTTTCACCCAGG - Intergenic
1140177499 16:72677543-72677565 CAGGGTCTCATTTGTCACCCAGG - Intergenic
1140613747 16:76634178-76634200 CGGAGTCTCACTTGTCACCCAGG - Intronic
1140681867 16:77393122-77393144 CAGGGACCATCTGGTCACCATGG + Intronic
1141433630 16:83984702-83984724 CAGGGTTTCTCTTGTCACCCAGG - Intronic
1141594390 16:85088559-85088581 CGGGGTACAACTGGTCACCTCGG - Exonic
1142071375 16:88092709-88092731 CAGGATCCCCCAGGACACCCTGG + Intronic
1142845118 17:2668651-2668673 CAGGGTCTCACTCTTCGCCCAGG - Intronic
1142877887 17:2863238-2863260 CAGGTTCCCACTAGTCTGCCTGG - Intronic
1143056971 17:4169757-4169779 CATGGTCCCACTGCAGACCCAGG - Intronic
1143167645 17:4905534-4905556 TAGGGTCTCGCTTGTCACCCAGG - Intergenic
1143257029 17:5566412-5566434 CATTGACCCACTGGTCACTCAGG + Intronic
1143613040 17:8031167-8031189 CAGGGTCTCCTTTGTCACCCAGG - Intergenic
1144450114 17:15370187-15370209 CTCAGTCCCACTGGTCACCCTGG - Intergenic
1144532159 17:16049914-16049936 CAGGGTCCCGCTCGTTGCCCAGG + Intronic
1145067054 17:19768717-19768739 CAGGGCCCCACAGGACACCAGGG + Intergenic
1145227352 17:21141200-21141222 CAGGAGGCCACCGGTCACCCAGG + Intronic
1145732331 17:27200243-27200265 GAGGGGCCCACTGGTAAGCCAGG + Intergenic
1145746982 17:27327390-27327412 CAGAGTCTCACTCGTCACCCAGG - Intergenic
1145761937 17:27430192-27430214 CAGGGTCCCCTTGGGCTCCCTGG - Intergenic
1145775962 17:27528877-27528899 CAGGGTCTCTCTTGTCACCCAGG - Intronic
1145927240 17:28657421-28657443 CAGGATCCCTCTTGTCACTCAGG + Intronic
1146065620 17:29632523-29632545 CAGGGTACCACTTGGCACCTGGG + Exonic
1146391209 17:32424868-32424890 CAGAGTCTCACTCGTCACCCAGG - Intergenic
1147634618 17:41956071-41956093 CTGAGTCTCACTTGTCACCCAGG + Intronic
1147902657 17:43799413-43799435 CAGAGTCTCATTTGTCACCCAGG + Intergenic
1148093330 17:45035665-45035687 CAGATGCCCACTGGTCCCCCTGG + Intronic
1148590244 17:48811092-48811114 CAGAGTCTCACTCGTCACACAGG + Intronic
1148629755 17:49098104-49098126 CTGGGTCTCACTCTTCACCCAGG + Intergenic
1148793886 17:50188130-50188152 CAGGGTCCTGCTGGTCCCGCCGG - Exonic
1148794286 17:50189713-50189735 CAGGGTGCTACTGGTTTCCCTGG - Exonic
1148795378 17:50194428-50194450 CAGGGTCCCGCTGGTGAACGTGG - Exonic
1148795767 17:50195957-50195979 CAGGGTCCCACCGGCCCCGCTGG - Exonic
1148796173 17:50197965-50197987 CAAGGTCCCCCTGGTGAGCCTGG - Exonic
1148800969 17:50225555-50225577 CAGTGTCCCAGTGGTGACTCTGG + Intergenic
1149432497 17:56605509-56605531 AATGGCCCCACTGTTCACCCAGG + Intergenic
1149786913 17:59443550-59443572 CAGGGTCTCACTTGTCACCCAGG + Intergenic
1150048610 17:61937203-61937225 CAGGGTCTCACTCGTCACCCAGG + Intergenic
1151232835 17:72697106-72697128 CAGGATCTCACTCGTCCCCCAGG + Intronic
1151526416 17:74671943-74671965 CAAGGTGCCAGGGGTCACCCAGG - Intronic
1151920701 17:77153091-77153113 CAGAGTTTCACTCGTCACCCAGG + Intronic
1152112229 17:78363394-78363416 CGGAGTCCCACCTGTCACCCAGG + Intergenic
1152396880 17:80038503-80038525 TAGAGTTTCACTGGTCACCCAGG - Intronic
1152434626 17:80268326-80268348 CAGGGTCTCACTGTCGACCCAGG - Intronic
1152804730 17:82350145-82350167 CAGAGTCTCACTCTTCACCCAGG + Intergenic
1152808336 17:82369035-82369057 CAGAGTCTCGCTGGTCGCCCAGG - Intergenic
1153311595 18:3682090-3682112 CAGGGTCTCGCCTGTCACCCAGG - Intronic
1153531976 18:6055987-6056009 CAGAGTTGCACTGGTCAGCCAGG + Intronic
1153877601 18:9388744-9388766 CAGGGTCTCACGAGTTACCCAGG + Intronic
1154145631 18:11864110-11864132 CGGAGTCTCACTCGTCACCCAGG + Intronic
1154205479 18:12333381-12333403 CAGGGTCTCACTTGTCACCCAGG + Intronic
1155041256 18:22067163-22067185 CAGAGTCTCACTTATCACCCAGG - Intergenic
1155257413 18:24011020-24011042 CAGGGTCTCACTCTTTACCCAGG - Intronic
1157590972 18:48836319-48836341 CAGGGTCCCCATGCTCAGCCTGG + Intronic
1157616266 18:48989500-48989522 CAGGGGCTCACCTGTCACCCAGG - Intergenic
1157708236 18:49827324-49827346 CAAGGTCCCACTGCCTACCCTGG - Intronic
1157815031 18:50724035-50724057 CAGGGTCTCACTTGTCACCCAGG + Intronic
1158222421 18:55163305-55163327 CAGGGTCACCCTTGTCACCCAGG - Intergenic
1158292228 18:55955103-55955125 CAGGGCCCCACTGTTCCGCCAGG + Intergenic
1158549408 18:58422471-58422493 CAGGATCTCACTTGTCACCCAGG + Intergenic
1160178725 18:76616656-76616678 CAGGGTCCCAGCGGTCAAGCAGG + Intergenic
1161217855 19:3103555-3103577 CAAGGTCTCACTTGTCACCCAGG + Intronic
1161260354 19:3334413-3334435 CAGGGTCCGATCTGTCACCCAGG + Intergenic
1161377476 19:3947348-3947370 CAGGGTCCCGCCAGTCCCCCAGG + Intergenic
1161469829 19:4451376-4451398 AAGGGTCTCACTTGTCACCCAGG + Intronic
1161553050 19:4924850-4924872 CAGTGTCTCACTTGTCGCCCAGG + Intronic
1161596601 19:5154004-5154026 CTGGGTCCCAGTGGCCATCCAGG - Intergenic
1162299142 19:9834557-9834579 TCGGCACCCACTGGTCACCCAGG + Intergenic
1162320545 19:9968709-9968731 CAGGGGCCCTCTGGCCTCCCAGG - Exonic
1162324276 19:9989503-9989525 CAGGGTCCCCCTGGAAACCCAGG - Exonic
1162444278 19:10712771-10712793 CAGGTTCCCAGTGGGCACCAGGG - Exonic
1162777540 19:12989034-12989056 CGGAGTCTCACTTGTCACCCGGG - Intergenic
1163038449 19:14585193-14585215 CAGGGTCTTGCTTGTCACCCAGG + Intronic
1163039145 19:14589454-14589476 CAGGGTCTTGCTTGTCACCCAGG + Intronic
1163089842 19:15011926-15011948 CAGGTTCTCACCTGTCACCCAGG - Intronic
1163251915 19:16131144-16131166 CAGGATCTCACTTGTTACCCAGG + Intronic
1163321490 19:16577361-16577383 CGAGGTCACGCTGGTCACCCCGG + Exonic
1163424684 19:17235059-17235081 CAGGCCCCCACTGGGCTCCCAGG - Intronic
1163544392 19:17932548-17932570 CTGCGTCCCACTGGTGACGCTGG - Intergenic
1163771035 19:19191597-19191619 CAGGGTCTCACTTGTCACCCAGG + Intronic
1164033703 19:21434718-21434740 CAGGGGCCCACTTGGCCCCCAGG - Intronic
1164479586 19:28601189-28601211 CAGGGTCTCACTTGTCACCCAGG + Intergenic
1164832453 19:31333078-31333100 CAGGATCTCCCTTGTCACCCAGG - Intronic
1165719887 19:38071622-38071644 CAGGGTCTCACTGTGCAACCAGG + Intronic
1166085852 19:40474453-40474475 CAGGGTCTCACTCTTCACCCAGG + Intronic
1166213567 19:41322117-41322139 CAGGGTCTCCTTTGTCACCCAGG + Intronic
1166232766 19:41435093-41435115 CAGGGTCCCACTGGGTAGCTGGG + Intronic
1166322376 19:42026592-42026614 CGGAGTCTCACTTGTCACCCAGG + Intronic
1166375493 19:42324839-42324861 CAGGGTCCCGGCGGTCACCACGG - Exonic
1166995117 19:46716417-46716439 CAGGGTCCCCCGGGGCCCCCCGG - Exonic
1167259502 19:48450515-48450537 CAGGGACTCACCGGTCACCCGGG - Exonic
1167409149 19:49334854-49334876 CAGGGTCTCACTTTTCACCCAGG - Intergenic
1168314468 19:55478450-55478472 CCTGGTCACTCTGGTCACCCAGG - Intronic
1168614436 19:57826519-57826541 TACGGTGCCACTGGGCACCCAGG - Intronic
925936361 2:8765716-8765738 CAAGGTTTCACTAGTCACCCAGG + Intronic
926098664 2:10099255-10099277 CAGGGTGACATTTGTCACCCAGG + Intergenic
926501400 2:13657686-13657708 CAGGGTCTTACTAGTCACTCAGG - Intergenic
926862240 2:17321527-17321549 CAGGGTCCCACTGTCCACCTGGG - Intergenic
927525260 2:23734180-23734202 CAGAGTCTCGCTCGTCACCCAGG + Intergenic
927753424 2:25689797-25689819 CAGGGTCTCACTCTTCACCCAGG + Intergenic
929191837 2:39147296-39147318 CAGATTCCCACTGGGCACCATGG + Intergenic
929479668 2:42293132-42293154 CAGGGTCTCACGCGTCACCCAGG + Intronic
929558716 2:42942330-42942352 ATGGGTCACCCTGGTCACCCTGG + Intergenic
930790409 2:55321082-55321104 CAGGGTCTCACTCATCTCCCAGG - Intronic
931465697 2:62484961-62484983 CAGGGTTTCACCTGTCACCCAGG + Intergenic
932359941 2:71096384-71096406 CACAGTCTCACTTGTCACCCAGG + Intergenic
932480712 2:72037418-72037440 CAGGACCCCAGGGGTCACCCTGG - Intergenic
934616815 2:95776472-95776494 CAGGGTCCCACTTGTTGCCCTGG + Intergenic
934644076 2:96048087-96048109 CAGGGTCTCACTTGTTGCCCTGG - Intergenic
934837492 2:97604181-97604203 CAGGGTCTCACTTGTTGCCCTGG - Intergenic
935981438 2:108631995-108632017 CAGTTTCCCTCTTGTCACCCAGG + Intronic
936390178 2:112065452-112065474 CAGGGTCTCACTTGTTGCCCAGG - Intronic
936747740 2:115599921-115599943 AATGGTCCCAGTGGTCAACCAGG + Intronic
937215400 2:120309640-120309662 CAGGGTCTCACTTGTCATCCAGG + Intergenic
937293347 2:120795194-120795216 CAGGGTCTCTCCTGTCACCCAGG - Intronic
937386816 2:121441718-121441740 CAGGGTCTCATTTGTTACCCAGG - Intronic
937558318 2:123187873-123187895 CAGGGTCTTACTTGTTACCCAGG - Intergenic
937575145 2:123411004-123411026 CAGGGTCTCACTTGTCGCCCAGG + Intergenic
937866142 2:126753056-126753078 CTGGGTCCCTCTGGTCTCCTCGG - Intergenic
940277443 2:151954117-151954139 CAGGGACACACTGATAACCCTGG - Intronic
940846103 2:158643686-158643708 CAGGGCCTCACTTGTCATCCAGG - Intronic
941675112 2:168335615-168335637 CAGAGTCTTACTTGTCACCCAGG - Intergenic
942685060 2:178522440-178522462 CGGAGTCTCACTCGTCACCCAGG - Intergenic
943128179 2:183823013-183823035 TACTGACCCACTGGTCACCCAGG - Intergenic
943673969 2:190698525-190698547 CAGGGTCTCACTTGTCACCCAGG + Intergenic
944126137 2:196294833-196294855 CAGGGTCCCTGTGGTCACTCAGG - Intronic
944199429 2:197090515-197090537 CAGAGTCTCACCTGTCACCCAGG + Intronic
946167212 2:217871659-217871681 CAGAGTCCCAGTGCTCACTCTGG - Intronic
946358649 2:219205830-219205852 CAGTGTCACTCTTGTCACCCAGG - Intronic
946935275 2:224713825-224713847 CAAGGTCACTCTTGTCACCCAGG + Intergenic
947165836 2:227261078-227261100 CCAGGTCCCAGTGGTCCCCCCGG + Exonic
947415055 2:229886485-229886507 CGGGATCTCACTGGACACCCAGG + Intronic
947416152 2:229898715-229898737 CAGGGTCCCACTGTCCACCAAGG + Intronic
947613185 2:231536472-231536494 CAGGGTCTTGCTTGTCACCCAGG + Intergenic
947898396 2:233697073-233697095 CAGGGTAACACTGGTCTCACAGG + Intronic
947947662 2:234120436-234120458 CTGGGTCCCCCAGGCCACCCCGG + Intergenic
948175972 2:235943386-235943408 CAGAGTTTCACTCGTCACCCAGG + Intronic
948870991 2:240797992-240798014 CTGGGTTCCACTGGTCCCGCTGG - Intronic
1168901940 20:1372170-1372192 TATGGTGCCACTGGGCACCCAGG - Exonic
1168990748 20:2094342-2094364 CAGAGTCTCACTCGTCGCCCAGG + Intergenic
1169209921 20:3760167-3760189 CAGGCTCCCGCTGGTGTCCCTGG - Exonic
1169483523 20:6006513-6006535 CCGGGCCCCACTGGCCGCCCGGG - Exonic
1169753893 20:9023398-9023420 CAGAGTCTCACATGTCACCCTGG - Intergenic
1170618409 20:17973614-17973636 CAGGGTCTTACTTGTCACCCAGG - Intronic
1171938211 20:31296604-31296626 CAGTGTCCCACTGGTCATTCAGG - Intergenic
1172097489 20:32467519-32467541 CAGGGTCCCACAGGCCTCCATGG + Intronic
1172373018 20:34410347-34410369 CAGAGTTTCACTTGTCACCCTGG - Intronic
1172422827 20:34831772-34831794 CAGGGTCTCATCTGTCACCCAGG - Intergenic
1173909083 20:46651025-46651047 CAGGTTCTCGCCGGTCACCCAGG - Intronic
1173969025 20:47136715-47136737 CAGGGTCTCCCCTGTCACCCAGG - Intronic
1174043542 20:47716982-47717004 TAGGGTCTCGCTTGTCACCCAGG - Intronic
1174448242 20:50604602-50604624 CAGGGCCGCTGTGGTCACCCTGG - Intronic
1174461843 20:50688864-50688886 CAGGGTCCCCCAGTTCATCCTGG - Intronic
1174492148 20:50907606-50907628 CAGGGTTCCACTTTTCATCCAGG + Intronic
1174570071 20:51495108-51495130 CAGCTTCCCACTCATCACCCAGG + Intronic
1174657604 20:52184650-52184672 CAGGGTCTCATTTGTCACCCAGG + Intronic
1174691141 20:52506520-52506542 CATTGTCCCACTGGTCATTCGGG - Intergenic
1174984343 20:55433024-55433046 CAGGGTCTCACTTACCACCCAGG - Intergenic
1175790104 20:61735550-61735572 CAGGGTCCCTGTGGCCCCCCAGG - Intronic
1175899330 20:62353842-62353864 CAGGGGCCCACTGAGCCCCCAGG + Intronic
1175974215 20:62702284-62702306 CAGGCTCCCTCTGCCCACCCTGG - Intergenic
1175974239 20:62702354-62702376 CAGGCTCCCTCTGCCCACCCTGG - Intergenic
1176051419 20:63121489-63121511 AAGGGACCCCCAGGTCACCCAGG + Intergenic
1178014571 21:28329141-28329163 CAGTCTCCCACAGGTCTCCCAGG - Intergenic
1178546236 21:33495171-33495193 CAGGGTCTCACCTATCACCCAGG - Intergenic
1178892426 21:36531200-36531222 CAGGGTCTCACTCTTCACCCAGG - Intronic
1179816583 21:43909955-43909977 CAGGGTGCCCCAGGACACCCTGG + Intronic
1179826269 21:43968197-43968219 CAGGGACCCCCTGCTCACCCCGG - Intronic
1180135488 21:45859496-45859518 CAGGGTCCCAAGGGCCACCTTGG - Intronic
1180622809 22:17172893-17172915 CAGGGTCTCACTGCCCAGCCTGG - Intergenic
1180998413 22:19976809-19976831 CAGGTTCCCACTGCACACCCTGG + Intronic
1181716356 22:24732790-24732812 CAGAGTCTCACTCGTCACCCAGG - Intronic
1181962301 22:26631238-26631260 CAAGGTTTCACTCGTCACCCAGG + Intergenic
1182091019 22:27594955-27594977 CACGGCCCCACTGGTCAAGCTGG + Intergenic
1182120131 22:27781120-27781142 CAGGGTCTCACTTGTTGCCCAGG + Intronic
1182284009 22:29233429-29233451 CAGGGACCCACTGGGCCTCCAGG + Exonic
1182480323 22:30604602-30604624 CAGGGTCTCACTCGTTGCCCAGG - Intronic
1182726152 22:32447629-32447651 CAGGGTCTCATTTGTCTCCCAGG + Intronic
1183352614 22:37342568-37342590 CTGGGTCCCACTGCTGCCCCTGG + Intergenic
1183878925 22:40809604-40809626 CAGGGTCTCACTGTGTACCCAGG - Intronic
1184221731 22:43105087-43105109 CAGTTTCCCTCTTGTCACCCAGG - Intergenic
1185320847 22:50199751-50199773 AAGGGTCCCACAGGTCAGCATGG - Intergenic
949464246 3:4328191-4328213 CAGGGTCTTGTTGGTCACCCAGG - Intronic
949529615 3:4941342-4941364 CAGGGTCTCACTCTTCACCCAGG - Intergenic
949871387 3:8592702-8592724 CAGGGACTCACCTGTCACCCAGG + Intergenic
950279756 3:11696762-11696784 CAGGGTCTCAGTCGTCGCCCAGG + Intronic
950289810 3:11774553-11774575 CAGGGCCCTACTGCTCTCCCTGG + Intergenic
951010567 3:17673333-17673355 CAGGGTCTCACCTGTCACTCAGG + Intronic
951130152 3:19032926-19032948 CATTGACCCACTGGTCACTCAGG - Intergenic
951899622 3:27644116-27644138 CAGGGTCTCACTATTTACCCAGG + Intergenic
952064094 3:29546999-29547021 CAGGGTCCCACTGGTCACCCAGG + Intronic
952353714 3:32565633-32565655 CAGAGTTTCACTCGTCACCCAGG + Intronic
952365218 3:32668402-32668424 CAAGGTTTCGCTGGTCACCCAGG - Intergenic
952452283 3:33443205-33443227 CAGGGTCTCATCTGTCACCCAGG - Intergenic
952787025 3:37165559-37165581 CAGGGTTTCACTGGTCAGGCTGG - Intronic
952802769 3:37312546-37312568 CAGGGTCTCACTTGTCACCTAGG + Intronic
953761652 3:45692347-45692369 CAGGGTCTCACTTGTCACCCAGG + Intronic
953945646 3:47144923-47144945 CAGAGTCTCACTTGTCGCCCAGG - Intronic
954118795 3:48482948-48482970 CAGGGTCTCATCTGTCACCCAGG + Intronic
954135416 3:48580038-48580060 CAGGGTCCCCCAGGACCCCCGGG - Exonic
954240434 3:49289438-49289460 CAGAGTACCACAGATCACCCAGG + Intronic
954477305 3:50759644-50759666 CGGGGTCTTACTTGTCACCCAGG - Intronic
956454118 3:69403921-69403943 CAGGGTCTCTCTTGTCACCCGGG + Intronic
956495370 3:69819937-69819959 CAGAGTCTCACTTGTCACCCAGG - Intronic
956863684 3:73349056-73349078 CAGGGTCCCTCATGTCACTCAGG - Intergenic
957106114 3:75889919-75889941 CAGCTTCCAACTGGTTACCCTGG + Intergenic
957177566 3:76830961-76830983 CAGGGTCTCACTGTGCACCCAGG - Intronic
959678857 3:109069128-109069150 CAGAGTCTCTCTTGTCACCCAGG - Intronic
960112168 3:113855677-113855699 CAGAGTCTCACTCGTCACCCAGG - Intronic
960551484 3:118981193-118981215 CAGGTTCTCACTCGTCACCCAGG + Intronic
960756446 3:121019115-121019137 CTGCATCCCACAGGTCACCCGGG - Intronic
960969460 3:123129350-123129372 CTGGGCCCCACTGGCCACCATGG - Intronic
961021055 3:123507227-123507249 CAGGGTCTTGCTCGTCACCCAGG - Intronic
961161604 3:124731178-124731200 CAGGGTCTCACTTGTCGCCCAGG - Intronic
961583638 3:127903775-127903797 CAGGGCCCCAGTGGTCACGGGGG + Intergenic
962570159 3:136704795-136704817 CAGGGACTCACTCTTCACCCAGG - Intronic
963778467 3:149463834-149463856 TACGGTGCCACTGGGCACCCAGG - Intergenic
964977185 3:162635596-162635618 CAGGGTTTCACTGGTTAGCCAGG - Intergenic
966375030 3:179287783-179287805 CAGGGTATCCCTTGTCACCCAGG - Intergenic
966388978 3:179431531-179431553 CAGAGTCTCACTCTTCACCCAGG - Intronic
966588304 3:181651760-181651782 CAGGGTCTCACTTGTTGCCCAGG + Intergenic
966812257 3:183857221-183857243 CAGCGTCTCACTTGTCACTCAGG - Intronic
968489828 4:883971-883993 CAGGGACTCACTGGGCACACAGG + Intronic
968637572 4:1689371-1689393 CAGAGTCTCACTCATCACCCAGG + Intergenic
968859336 4:3153888-3153910 CAGGGTCTCACTCGTCACCCAGG - Intronic
969259190 4:6022849-6022871 CAGGCTCCCACAGGCCACCGTGG - Intergenic
969377027 4:6769560-6769582 CAGGGGCCCACTGCTCAGCCTGG + Intergenic
970453739 4:16200346-16200368 CAGGGTCTCACTCATCACCCAGG + Intronic
970589856 4:17550030-17550052 CAGGGTCTCACTTCTCACCCAGG + Intergenic
971331458 4:25685024-25685046 CAGTATCCCTCTTGTCACCCAGG + Intergenic
972319881 4:37963919-37963941 CAGGGACCCTGTAGTCACCCTGG - Intronic
972319948 4:37964412-37964434 CAGGATCCAACTGGACACTCAGG + Intronic
972518702 4:39833405-39833427 CAGGGTCTCCTCGGTCACCCAGG + Intronic
972645497 4:40964221-40964243 CAGATTTCAACTGGTCACCCTGG + Intronic
973236571 4:47912985-47913007 CAGAGTCTCGCTGGTCGCCCAGG - Intronic
974066257 4:57080551-57080573 CAGGATCTCACTTTTCACCCAGG + Intronic
974147975 4:57969477-57969499 CAGGAACTCACTTGTCACCCAGG + Intergenic
974900689 4:67993584-67993606 CAGCGTCCCACAGGTCCCACAGG - Intergenic
976168607 4:82280989-82281011 CAGGGTCTCACTGGTCACCTAGG - Intergenic
976226209 4:82797556-82797578 CAGGTTCCCACTGGCCACATGGG + Intronic
976965787 4:91039052-91039074 CAGGGTCTCACTCTGCACCCAGG + Intronic
977430603 4:96927011-96927033 CAGGGACCCACTGGACCCACTGG - Intergenic
978575844 4:110189257-110189279 CAGGGTCTTGCTTGTCACCCAGG - Intronic
979990217 4:127366646-127366668 GAGGGTCCCACCTGTCACTCTGG - Intergenic
980105671 4:128585838-128585860 CAAGGTCTCACTCGTCGCCCAGG - Intergenic
980435378 4:132764977-132764999 CAGGGTCTCACTTGTCACCCAGG - Intergenic
980754466 4:137139517-137139539 CAGAGTTTCACTCGTCACCCAGG + Intergenic
981114465 4:140973849-140973871 CAGAGTCTCACTTGTCACCCAGG - Intronic
981321746 4:143399962-143399984 TAGGGTCTCACCTGTCACCCAGG + Intronic
983019722 4:162660446-162660468 CAGGGTTTCACCTGTCACCCAGG + Intergenic
983450579 4:167906455-167906477 CAGAGTCTCACTCGTCACCCAGG + Intergenic
983570870 4:169206982-169207004 CAGGGTTTCACTCGTCACCCAGG + Intronic
984119789 4:175727926-175727948 CACGGTAACACTGGTCTCCCAGG - Intronic
984966493 4:185144323-185144345 CAGTGTCACTCTGATCACCCTGG - Intronic
985129935 4:186728877-186728899 CAGAGTTCCACTGGACACCTTGG + Intergenic
985476523 5:82406-82428 CAGGCTCCCACTGAGCTCCCTGG + Intergenic
985559203 5:574001-574023 CAGGGTCCTGCTGGGCACCCAGG - Intergenic
985695705 5:1338940-1338962 CAGTGTCCCACTGGCGACCGCGG - Exonic
985762079 5:1754380-1754402 CGGAGTCTCACTTGTCACCCAGG + Intergenic
985825539 5:2188055-2188077 CAGGATACCCCTGGACACCCAGG + Intergenic
986211073 5:5673050-5673072 CAGAATCTCACTTGTCACCCAGG + Intergenic
986725717 5:10594962-10594984 CTGGGTCCCACCAATCACCCGGG - Intronic
987927030 5:24354903-24354925 CAGGGTCTCATCTGTCACCCAGG - Intergenic
989179761 5:38564797-38564819 CAGAGTCTCACTTGTCACCCAGG + Intronic
989384812 5:40844892-40844914 CAGAGTCTCACTCGTCGCCCAGG + Intronic
989550630 5:42731706-42731728 CAGGGTCTCACTCGTCACCTGGG - Intergenic
989970421 5:50517972-50517994 CATTGCCCCACTGGTCACTCAGG + Intergenic
990470293 5:56109009-56109031 CAGAGTCTCACTTGTCACCCAGG - Intronic
990470969 5:56115172-56115194 CAGAGTCTCACTTGTCATCCAGG - Intronic
991016102 5:61934247-61934269 CAGGGCTCCACTTGTCTCCCAGG + Intergenic
991607751 5:68420367-68420389 CAGGGTCCCACTGGAGACTGGGG + Intergenic
992313193 5:75524102-75524124 CGGAGTCTCACTCGTCACCCAGG - Intronic
992703292 5:79362527-79362549 CAGAGTTTCACTCGTCACCCAGG + Intergenic
993881993 5:93374111-93374133 CAGAGTCTCACTCGTCACCCAGG + Intergenic
993981607 5:94549333-94549355 CAGTGACCCACTGGTCATTCAGG - Intronic
994321600 5:98401161-98401183 CAGGGACCCTCTGGTCTCCAGGG + Intergenic
994768875 5:103955972-103955994 CAGGCTCCAGCTGGTGACCCAGG + Intergenic
996349400 5:122522178-122522200 CAGAGTCTCACTAGTCACCCAGG + Intergenic
996410322 5:123151763-123151785 CAGGGTCCCCCAGCTCACCTTGG + Intronic
996697454 5:126414482-126414504 CAGGGTCTCACTCATCACTCAGG + Intronic
997192079 5:131946474-131946496 CAGGGTCTGGCTTGTCACCCTGG + Intronic
997956457 5:138282185-138282207 CAGGGTCTCACTTGTTGCCCAGG - Intergenic
997993439 5:138565737-138565759 CAGGGTCTCATTTGTCACCCAGG + Intronic
998413741 5:141930270-141930292 CAGGGTCCATTTGGTTACCCAGG - Exonic
998427412 5:142040552-142040574 AAGGCTCCCACTCCTCACCCAGG - Intergenic
998601553 5:143590564-143590586 CTGGGTCTCACCTGTCACCCAGG + Intergenic
998721717 5:144959504-144959526 CAGGGTCTCACTCTTCACCCAGG + Intergenic
999255179 5:150206013-150206035 CTGTGTCCCACTGGTGGCCCGGG + Intronic
999389812 5:151181847-151181869 CATGGTCAGACAGGTCACCCAGG - Exonic
999721323 5:154401102-154401124 CAGGGTCACCCTGGTCCCTCAGG + Intronic
1000617548 5:163445477-163445499 CAGGGTCACTCTTGTCACCCAGG + Intronic
1001053254 5:168429282-168429304 CAGGGTCTCACCTGTCACCCAGG + Intronic
1001200463 5:169711361-169711383 CAACAACCCACTGGTCACCCAGG - Intronic
1001665689 5:173431922-173431944 CAGGGTCTCACTGTCAACCCAGG - Intergenic
1001730431 5:173950577-173950599 CAGAGTCTCACTTTTCACCCAGG - Intronic
1001772791 5:174308595-174308617 CTGGGTCCCCCTGGTTAACCCGG + Intergenic
1002047500 5:176550134-176550156 CAGGGTCCCAGTGAGCACCGAGG + Intronic
1002122608 5:177016995-177017017 GAGGTTCACACTTGTCACCCAGG - Intronic
1003083298 6:3039874-3039896 CAGGGTCTCCTTTGTCACCCAGG - Intergenic
1003216315 6:4116323-4116345 CAGAGTCTCACTTGTCACCCAGG - Intronic
1003367810 6:5493181-5493203 CAGTCTCCCTCTTGTCACCCAGG - Intronic
1004094392 6:12538501-12538523 CAGGGTCTCACTGGGTGCCCAGG + Intergenic
1004280737 6:14277553-14277575 CATGTTCTCACAGGTCACCCAGG - Intergenic
1004720024 6:18260958-18260980 CAAGGTCTCACTTGTCACCCAGG - Intronic
1005299431 6:24456369-24456391 CAGAGTCTCACTTGTCACCCAGG - Intronic
1005414893 6:25589511-25589533 CAGGGTCTCACCTGTCACCCAGG + Intronic
1005441623 6:25875380-25875402 CAGGCTCCCACTTCTCAGCCAGG - Intronic
1006035443 6:31207847-31207869 CAGAGTCTCACTCATCACCCAGG - Intergenic
1006470596 6:34226651-34226673 CTTGGTCCCACAGGTCCCCCAGG - Intergenic
1008505477 6:52225759-52225781 CAGAGTCTCGCTCGTCACCCAGG + Intergenic
1008853976 6:56059164-56059186 CAAGGTCCTCCTGGTCCCCCAGG - Exonic
1009397030 6:63211803-63211825 TATGGTGCCACTGGGCACCCAGG + Exonic
1009432732 6:63584558-63584580 CAGGATCTCACTTGTCACCCAGG + Intergenic
1010098679 6:72077155-72077177 CAGGATCCCACTCCTCACTCAGG + Intronic
1010839134 6:80626565-80626587 CATTGACCCACTGGTCACTCAGG - Intergenic
1011144905 6:84203468-84203490 CAGGGTCTCACTCATCAACCAGG + Intronic
1011627331 6:89294168-89294190 CAGAGTCTCACTCGTCGCCCAGG + Intronic
1011683943 6:89809189-89809211 CAGTGTCTCACCTGTCACCCAGG - Intronic
1012280332 6:97320940-97320962 CAGAGTTTCACTTGTCACCCAGG + Intergenic
1012400132 6:98835609-98835631 CAGGGTCCGCCTGGCCACCCAGG + Exonic
1012475295 6:99609858-99609880 CAGGGTCTCACTTGTCACCCAGG - Intronic
1014051544 6:116961460-116961482 CAGGGTCCCCTCTGTCACCCAGG + Intergenic
1015944257 6:138483905-138483927 GATGGCCCCATTGGTCACCCAGG + Intronic
1016567834 6:145476690-145476712 CAGTGACCCACTGGTCATTCAGG - Intergenic
1017166952 6:151417832-151417854 CAGAGTCACTCTTGTCACCCAGG + Intronic
1018026339 6:159809304-159809326 TAGGGTCTCACCTGTCACCCAGG + Intronic
1018129600 6:160716409-160716431 CAGGGTCCCACTTATTGCCCAGG - Intronic
1018168772 6:161127083-161127105 CTGTGTCACACAGGTCACCCAGG + Intergenic
1018523410 6:164679079-164679101 CAGAGTCTCACTTGTCACCCAGG - Intergenic
1018818016 6:167350507-167350529 CAGGGTCCCCCGGCTCCCCCGGG - Intronic
1019142350 6:169956858-169956880 CGGGGTCCCGCTGGGCACCTGGG - Intergenic
1019466033 7:1189560-1189582 CAGCGTCTCACTTGTCACCCAGG - Intergenic
1019827479 7:3296466-3296488 CAGAGTCTCACCTGTCACCCAGG - Intergenic
1020108617 7:5435130-5435152 CAGGGTCTCACTTGTCACCCAGG + Intronic
1020791673 7:12635142-12635164 CAGAGTCTCACTCATCACCCAGG - Intronic
1021106310 7:16643967-16643989 CAGGATCTCACTCTTCACCCAGG - Intronic
1021113026 7:16717147-16717169 CAGGGTCTCCCTAGTTACCCAGG + Intergenic
1021780946 7:24105332-24105354 CAGGGTTCCCCTGGTCGACCTGG + Intergenic
1022445436 7:30466639-30466661 AGGGGTCTCACTTGTCACCCAGG - Intronic
1022490934 7:30817112-30817134 CAGAGTCCCACTGAGCTCCCAGG + Intronic
1023429513 7:40074793-40074815 CAGGGTTCCACTGCTACCCCAGG - Intronic
1023752593 7:43386357-43386379 AAGGGTCCCCCTAGTCATCCTGG + Intronic
1023791232 7:43755358-43755380 CAGAGTCTCACTCGTCGCCCAGG + Intergenic
1024191586 7:47016933-47016955 CAGCGTCTCACTCGTCACCCAGG - Intergenic
1025903867 7:65769241-65769263 CAGGGTCTGGCTCGTCACCCAGG + Intergenic
1026141857 7:67713327-67713349 CAGGTACCCACTGCTCAGCCAGG + Intergenic
1026342230 7:69444513-69444535 CTGGATCTCACTCGTCACCCAGG + Intergenic
1026433995 7:70377794-70377816 CAGAGTCTCACTTGTCGCCCAGG + Intronic
1026725471 7:72867023-72867045 CAGGGTCTCACTAGTTGCCCAGG - Intergenic
1027085540 7:75261097-75261119 CAGAATCTCACTCGTCACCCAGG - Intergenic
1028753998 7:94413918-94413940 CAGGGTCCCCCTGGTCCTCCAGG + Exonic
1028754562 7:94420538-94420560 CAGGGTGCTGCTGGTCAACCTGG + Exonic
1028754611 7:94421006-94421028 TAGGGTCCAAATGGTCCCCCCGG + Exonic
1028755365 7:94427624-94427646 CAGGGCCCCCCTGGTCCCCCTGG + Exonic
1029597877 7:101547218-101547240 CGGGGTCCCCCTGGTCCACCAGG + Exonic
1029600256 7:101559119-101559141 CAGAGGCCCTGTGGTCACCCCGG - Intergenic
1029990075 7:104955096-104955118 CACGGTCTCACCTGTCACCCAGG + Intergenic
1030684971 7:112476621-112476643 CAAGGTCTCACTCGTCACCCAGG - Intronic
1030768608 7:113443449-113443471 CAGGGTTTCACTGGTTTCCCAGG - Intergenic
1031520715 7:122761970-122761992 CAGAGTCTCACTTTTCACCCAGG - Intronic
1032256764 7:130303652-130303674 CAGGGTCTCACTTGTTGCCCAGG + Intronic
1032525047 7:132573705-132573727 CAGTGTCCCAGTGGGCATCCAGG + Intronic
1033159345 7:138982043-138982065 CAGGGTCCCGCGGGCCTCCCAGG - Intergenic
1034330520 7:150278365-150278387 CAGGGGCTCAGTGGCCACCCTGG + Intronic
1034667523 7:152831483-152831505 CAGGGGCTCAGTGGCCACCCTGG - Intronic
1035567229 8:649729-649751 CATGGTCACACTGCTCAGCCAGG - Intronic
1036210188 8:6834980-6835002 CAGGGTCCCCCTGGACGGCCGGG + Intronic
1036522020 8:9500680-9500702 CAGAGTCTCCCTGGTCACCCAGG - Intergenic
1036932982 8:12974143-12974165 CAGGGTCTTGCTTGTCACCCAGG - Intronic
1037278727 8:17211513-17211535 CAGGGTCTCTCTTGTCACCCAGG + Intronic
1037916463 8:22776068-22776090 GAGGGTCCCAGTGGTCCCCAGGG - Intronic
1037943141 8:22969775-22969797 CAGGGTCTCACTCGTCATCTAGG + Intronic
1038036272 8:23689466-23689488 CAGGTTCTCACTGTTAACCCAGG + Intergenic
1038314195 8:26468892-26468914 CAGGGTCTCACCTGTTACCCAGG + Intronic
1038440573 8:27568648-27568670 CAGATTTCCACTGGGCACCCTGG + Intergenic
1038455830 8:27671292-27671314 CAGGGTCCCCCTGGTCTCCCGGG + Exonic
1040462798 8:47664868-47664890 CAGGGTCTCACTCTGCACCCAGG - Intronic
1040507082 8:48058549-48058571 CAGGGTCTCACTCGTTGCCCAGG - Intronic
1040600570 8:48879646-48879668 TAGAGTCTCACTTGTCACCCAGG - Intergenic
1040643599 8:49371190-49371212 CAGCGTTTCACTTGTCACCCAGG + Intergenic
1042163002 8:65916358-65916380 CAGTGACCTACTGGTCACTCAGG - Intergenic
1042223699 8:66498306-66498328 CAGGGTCTCACTGTTTGCCCAGG - Intronic
1042292324 8:67182025-67182047 CAGGGTCACCCTTGCCACCCAGG + Intronic
1042891024 8:73610248-73610270 CAGGGTCTCACTTGTTGCCCAGG - Intronic
1043464603 8:80492502-80492524 TGGGGTCTCACTTGTCACCCAGG + Intronic
1043887399 8:85617751-85617773 CAGGGTCTCACTTGTGGCCCCGG + Intergenic
1043953156 8:86331854-86331876 CAGGGTCTTGCTCGTCACCCAGG + Intergenic
1044976472 8:97670288-97670310 CAGGGTCTCACTCTTCACCCAGG - Intronic
1045673585 8:104585249-104585271 CAGAGTTTCACTCGTCACCCAGG + Intronic
1046777339 8:118178489-118178511 CAGTCTCCCTCTTGTCACCCAGG + Intergenic
1046899485 8:119508639-119508661 CAGAATCTCACTTGTCACCCAGG - Intergenic
1047905312 8:129466892-129466914 CAAGGTCTCACTCTTCACCCAGG + Intergenic
1048141897 8:131803011-131803033 CAGGGTCTCACCTGTCCCCCAGG + Intergenic
1048797410 8:138163845-138163867 CAGGGTCTCACCTGTCACCCAGG + Intronic
1049400391 8:142424121-142424143 CAGGCTCCCACCCGGCACCCTGG - Intergenic
1049538400 8:143193759-143193781 CAGGGCCACACGGGGCACCCGGG - Intergenic
1049751688 8:144287524-144287546 CAGGGTCTTGCTTGTCACCCAGG + Intronic
1050578347 9:7023881-7023903 CATGGACCCACTGGTCATTCAGG + Intronic
1050984779 9:12068317-12068339 CACAGTCTCACTTGTCACCCAGG - Intergenic
1051381940 9:16468064-16468086 CAGGTTCTCACCTGTCACCCAGG + Intronic
1052006673 9:23357704-23357726 CTGTGTCACACTGGTCACCAGGG + Intergenic
1052063608 9:23990263-23990285 CATTGTCCCACTGGTCATCCAGG - Intergenic
1053439587 9:38105290-38105312 CAGGGTCTCCCCTGTCACCCAGG + Intergenic
1053484361 9:38440987-38441009 CAGAGCCTCACTCGTCACCCAGG + Intergenic
1055023312 9:71692874-71692896 CAGGGTCTCCCTCTTCACCCAGG - Intronic
1055037784 9:71836745-71836767 CAGGGTCTCACTTTTTACCCAGG - Intergenic
1055519479 9:77065688-77065710 CAGGGTCTCATCTGTCACCCAGG - Intergenic
1055886210 9:81066306-81066328 CATGGACCCACTGGTCATTCAGG + Intergenic
1057123707 9:92599934-92599956 GTGGGTCCCACTGGTCCCCCAGG - Intronic
1057560710 9:96126015-96126037 CAGGGTCTCAACTGTCACCCAGG - Intergenic
1057708126 9:97412317-97412339 CGCGGTCCCACCGGTGACCCAGG - Intronic
1058295314 9:103299217-103299239 CAGGGTCCTCTTTGTCACCCAGG - Intergenic
1058696581 9:107564179-107564201 CAGGGTCTCACTTGTTGCCCAGG - Intergenic
1059157811 9:112005385-112005407 CAGAGTCTCACTCATCACCCAGG - Intergenic
1059418763 9:114178288-114178310 CAGGGTCCCCCTGGGCTACCTGG + Exonic
1060879133 9:127105451-127105473 CAGGGACCCACTAGTCACTTGGG + Intronic
1060932752 9:127499029-127499051 CAGAGTTTCACTTGTCACCCAGG - Intronic
1061194461 9:129100241-129100263 CAGGATTGCACTGGTGACCCCGG + Intronic
1061701642 9:132420640-132420662 CAGAGTCTCACTTGTCACCCAGG - Intronic
1062105004 9:134750539-134750561 CAGGGCCCCCCTGGACGCCCAGG + Exonic
1062109647 9:134774874-134774896 CAGGGTCCGATTGGCTACCCAGG + Exonic
1062426678 9:136509215-136509237 CGGGTTCCCACTGGCCTCCCTGG - Intronic
1062467607 9:136687935-136687957 CAGGTGGCCACTGGTCACTCGGG - Intergenic
1062615291 9:137393441-137393463 CAGGGCCCCACAGGACAGCCAGG + Intronic
1203783886 EBV:116415-116437 CAGGCTCCCACTTGTCCCGCTGG + Intergenic
1185805830 X:3056150-3056172 CAGGGTCTCACTAGTTGCCCAGG + Intronic
1187329117 X:18319569-18319591 CAGAGTCTCACCTGTCACCCAGG - Intronic
1187407170 X:19014656-19014678 CAGAGTCTCACTCGTCACCCAGG + Intronic
1189440588 X:41032251-41032273 CAGTTTCCCTCTTGTCACCCAGG + Intergenic
1189466127 X:41278913-41278935 CAGAGTCTCACTCGTCACCCAGG + Intergenic
1189747571 X:44185560-44185582 CAGGGTCTCACTCTGCACCCAGG + Intronic
1189756418 X:44276229-44276251 CAGGGACCCATGTGTCACCCAGG - Intronic
1190719988 X:53139798-53139820 CAGGGTCTTGCTTGTCACCCAGG - Intergenic
1192109576 X:68350705-68350727 CAGGGTCTCACTTGTTGCCCAGG + Intronic
1192335759 X:70217908-70217930 CAGAGTCTCACTTGTCACCCAGG - Intergenic
1192370215 X:70506781-70506803 CAGGGTCTCATCTGTCACCCAGG + Intergenic
1192796698 X:74429444-74429466 CAGGGTCTCACTTGTCACCCAGG - Intronic
1192991835 X:76467629-76467651 CTGGGTCACACAGGTCACCAAGG + Intergenic
1195052886 X:101114231-101114253 CAGAGTCTCGCTCGTCACCCAGG - Intronic
1195667883 X:107447343-107447365 CAGTGCCTCACTGGTCACCCAGG + Intergenic
1195751644 X:108165450-108165472 CAGGGCCCTGCTGGTCTCCCCGG - Exonic
1195799141 X:108687523-108687545 CAAGGTCCCCCAGGTCCCCCTGG + Exonic
1195834605 X:109099708-109099730 CATTGACCCACTGGTCATCCAGG + Intergenic
1196267793 X:113672628-113672650 CAGAGTCCCATTTGTCACCCAGG + Intergenic
1196573540 X:117291378-117291400 CATTGACCCACTGGTCACTCAGG - Intergenic
1197731768 X:129816906-129816928 CAGTTTCACACTTGTCACCCAGG + Intronic
1197803883 X:130380808-130380830 CAGGGTCTCGCTCATCACCCAGG - Intergenic
1198702295 X:139410757-139410779 CATTGACCCACTGGTCACTCCGG + Intergenic
1200458942 Y:3429614-3429636 CATTGTCCCACTGGTCATTCAGG - Intergenic
1201289206 Y:12406481-12406503 CAGGGTCTCACTCGTCGCCCAGG - Intergenic