ID: 952064094

View in Genome Browser
Species Human (GRCh38)
Location 3:29546999-29547021
Sequence CAGGGTCCCACTGGTCACCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 747
Summary {0: 1, 1: 0, 2: 26, 3: 121, 4: 599}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952064094 Original CRISPR CAGGGTCCCACTGGTCACCC AGG Intronic