ID: 952067852

View in Genome Browser
Species Human (GRCh38)
Location 3:29593533-29593555
Sequence CTTTATATAGTGATGGACAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 170}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952067849_952067852 5 Left 952067849 3:29593505-29593527 CCTGAGACTGGGTGGGAAACAAT 0: 1
1: 0
2: 1
3: 21
4: 187
Right 952067852 3:29593533-29593555 CTTTATATAGTGATGGACAAGGG 0: 1
1: 0
2: 0
3: 9
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952067852 Original CRISPR CTTTATATAGTGATGGACAA GGG Intronic
902460029 1:16567490-16567512 CTTTATATTGGGATAGACTAGGG + Intronic
909328371 1:74381601-74381623 CTTTCTATAGAGAAGGTCAAGGG + Intronic
910372861 1:86536664-86536686 ATTAATATACTAATGGACAAAGG - Intergenic
911493219 1:98595295-98595317 CTTCATCTATTGATGGACACAGG + Intergenic
911905691 1:103565747-103565769 CTTTATATAGGTATGGATACTGG + Intronic
913137970 1:115911123-115911145 CTATATAAACTGATGGAAAAAGG - Intergenic
913834167 1:123300884-123300906 CTTCATATACTGCTGGACAGAGG + Intergenic
914366594 1:146984652-146984674 CTTTATGTTGTGATAGACTAGGG - Intronic
917018988 1:170565882-170565904 ATTTGTAAATTGATGGACAAAGG - Intergenic
917208416 1:172603246-172603268 ATTTATTTAGTGTTAGACAATGG - Intronic
917472155 1:175335065-175335087 ATTTTCATAGTGATGGATAAAGG - Intronic
918792178 1:188842800-188842822 CTTTTTAAATTGAAGGACAAGGG + Intergenic
919101938 1:193106111-193106133 CCTTAAATAGTGACGCACAAAGG - Exonic
919381635 1:196868214-196868236 CTTTATGGAATGATAGACAAAGG - Intronic
920709386 1:208280511-208280533 CTTTATATAGTGCAGGGTAAAGG + Intergenic
922898058 1:229115743-229115765 CCTGTTATAGTGATAGACAAGGG - Intergenic
923684428 1:236143864-236143886 CTTTGTATAGCGTTGCACAAAGG + Intronic
1064962903 10:20985811-20985833 TTTTATATAGAGATGCACACTGG - Intronic
1069300895 10:66905620-66905642 CTTTATCTAGTCATGATCAATGG - Intronic
1071105455 10:82088655-82088677 CTTTGTATAGTCATATACAAAGG - Intronic
1072077285 10:91990354-91990376 CCTTATATAGCAATGGACCAGGG - Intronic
1072185517 10:93034464-93034486 CTTTCTATGGTGATGTACATGGG - Intronic
1072786971 10:98290269-98290291 CTTCATTTATTGAGGGACAAAGG + Intergenic
1077526040 11:3065843-3065865 TTGTATATAGTGAAAGACAAGGG + Intergenic
1079232090 11:18657543-18657565 CTTTATATGGTGATGGGGAAGGG - Intergenic
1079698896 11:23519468-23519490 CATTTTACAGTGAAGGACAAGGG - Intergenic
1079922366 11:26448526-26448548 CTTTAAATAGTTATGGTCAAAGG + Intronic
1080158915 11:29147535-29147557 CTTCATTCAGTGATAGACAAAGG - Intergenic
1086587181 11:88466966-88466988 ATTTATCTACTGATGGACACAGG + Intergenic
1087788953 11:102386881-102386903 CTTTATATATTCATGAACATGGG + Intergenic
1091341359 11:134817590-134817612 ATTTATATAGTCATTGAAAAAGG + Intergenic
1094200510 12:27790644-27790666 CTTGAAAAAGAGATGGACAATGG - Intronic
1094692737 12:32785812-32785834 CTTTCTATTGTGTTGGAAAAGGG + Intergenic
1094704712 12:32903308-32903330 CTGTATATATTGATGGATATAGG + Intergenic
1094734302 12:33216493-33216515 CTTTATATAGTGATCTGTAAGGG + Intergenic
1099504852 12:83461009-83461031 TTTTCTATATTGATGTACAATGG + Intergenic
1100312009 12:93404645-93404667 CTTTCAATAGTGATTGAAAAAGG + Exonic
1101292959 12:103389749-103389771 CTCTATATCTTCATGGACAATGG - Intronic
1101472889 12:105015495-105015517 TTTTATATTGTGATTGACTATGG - Intronic
1101647279 12:106643103-106643125 CTGTATTCAGTGATGGACAATGG - Intronic
1106871715 13:34029087-34029109 CTGAATATACAGATGGACAATGG + Intergenic
1107265522 13:38549041-38549063 TTTTATATAGTGAGAGACAGGGG + Intergenic
1110421331 13:75312886-75312908 CTTTCAACAGTGATGGAGAAGGG - Exonic
1110757295 13:79190276-79190298 ATTTATATATTGATTAACAAAGG - Intergenic
1113379791 13:109793238-109793260 GTTTATATTGTGAGAGACAAGGG - Intergenic
1115043995 14:28967248-28967270 CTTTATTTAATGAAGGAGAAGGG + Intergenic
1115377349 14:32692401-32692423 CTTTTTATAGTGAAAGATAAAGG - Intronic
1117807616 14:59510792-59510814 CTTTAGATCTTGGTGGACAATGG - Exonic
1119598919 14:75961334-75961356 CTTTGTATTGTGATAGAAAAGGG - Intronic
1120177455 14:81310129-81310151 CTTTATATTATGAAAGACAACGG + Intronic
1120741654 14:88115485-88115507 CTTTATATATTAATTGAGAAGGG + Intergenic
1121416196 14:93780757-93780779 CTCTGTATAGTGAGGGACACTGG - Intronic
1123895489 15:24825338-24825360 ATTTATGTAATGAAGGACAAGGG + Intronic
1124553020 15:30699569-30699591 CTGTATATAGTCATTGACAATGG - Intronic
1124678223 15:31706101-31706123 CTGTATATAGTCATTGACAATGG + Intronic
1125804719 15:42483591-42483613 CTTTTAATAGTGAGGGACAAAGG - Intronic
1126216696 15:46163665-46163687 ATTTATCTATTGATGGACACAGG - Intergenic
1129809778 15:78500172-78500194 CTATATATAGTTATGGGCAGAGG + Exonic
1131161862 15:90110822-90110844 GTTTATGAAGTGTTGGACAAGGG + Intergenic
1134584334 16:15397160-15397182 TTTTATAAGGTGATGGAGAAAGG + Intronic
1140353295 16:74283149-74283171 CTTGAAATAGGGAAGGACAAAGG - Intergenic
1140967933 16:79985237-79985259 CCTTATATTGTGAAGGAGAATGG + Intergenic
1142581743 17:947365-947387 TTTTACACAGTTATGGACAATGG + Intronic
1148191882 17:45684838-45684860 TTTTATATAATGATGCACCAAGG + Intergenic
1149068550 17:52510326-52510348 CTTTCTATAGTCATCGACACTGG + Intergenic
1150917899 17:69455165-69455187 CTTCATTTAGTGAGGGATAATGG + Intronic
1156200313 18:34823401-34823423 TTTTATACAGTGCTGTACAATGG + Intronic
1156264570 18:35475203-35475225 CATTACATAGAGATGAACAAAGG + Intronic
1156771645 18:40734818-40734840 ATTGATATATTGATGAACAAAGG - Intergenic
1159658442 18:71061527-71061549 CTTTCTATACTCAAGGACAAAGG + Intergenic
1160075837 18:75675712-75675734 ATTTTTATAGTGTTGGAGAATGG + Intergenic
1164345398 19:27248943-27248965 CTTTATATAATGCTAGACAGAGG + Intergenic
1165129937 19:33625488-33625510 ATTTATATAGTGCTGGCCCAAGG + Intronic
928722417 2:34134909-34134931 CTTTAATTAGTGAATGACAATGG - Intergenic
929278675 2:40053975-40053997 CATTATCCATTGATGGACAATGG - Intergenic
932493775 2:72136746-72136768 CTTCAGAGAGTGATGGATAAAGG + Intronic
932663754 2:73679788-73679810 CTTTATAGAGTGATCGAGAGGGG + Intergenic
933327849 2:80861775-80861797 CTTGATATAGTGAAAGACCATGG + Intergenic
936382923 2:112003666-112003688 CTTAATAAAGTGATGAGCAAAGG + Intronic
937813198 2:126221587-126221609 CTGAATATACAGATGGACAATGG + Intergenic
939630403 2:144521777-144521799 CTTAATATAGTGTTGGATCAGGG - Intronic
939775747 2:146385555-146385577 CTTTATAACGTTATGGCCAAAGG - Intergenic
943188310 2:184642891-184642913 CTTGATATGGTAATGGATAATGG + Intronic
943247909 2:185478900-185478922 CCTTATATAATAATGTACAAAGG + Intergenic
943569128 2:189551933-189551955 CTTTATATTGTGATGTGGAAGGG - Intergenic
945629092 2:212249321-212249343 TTTTATATAATAATGGAGAATGG + Intronic
947405477 2:229771716-229771738 CTTTATAAAGTGATCCAGAAGGG - Intronic
1169636184 20:7694469-7694491 CATTATATATTGAAGGAAAATGG + Intergenic
1170125588 20:12959918-12959940 TTTAATATGGTGATGGGCAATGG - Intergenic
1173100984 20:40088394-40088416 CTGTTTATAGTAATGGAAAATGG - Intergenic
1174090204 20:48040570-48040592 TTTTCAATAGTGATGGACCATGG + Intergenic
1179633302 21:42691890-42691912 CTTTGGATAGTGATGGTAAAGGG - Intronic
1183541709 22:38433034-38433056 TTTTAGAAAGTGATGGACATAGG + Intronic
1184994790 22:48197529-48197551 CTGTAGATGGTGGTGGACAATGG - Intergenic
952067852 3:29593533-29593555 CTTTATATAGTGATGGACAAGGG + Intronic
956912930 3:73839360-73839382 TTTTATATAGTGAAAGACAGAGG - Intergenic
957801961 3:85096766-85096788 CTTTATATATTGCTGTAGAATGG - Intronic
957897094 3:86436648-86436670 CTTTCTATTTTGATGGACTATGG + Intergenic
958859431 3:99428279-99428301 CTTTATATATTTATTGAAAATGG + Intergenic
958911514 3:99999483-99999505 CTTTATTTAGAGTTGGATAAGGG + Intronic
958960906 3:100508790-100508812 TTTTATATAGTGAGAGACAGGGG - Intronic
960869506 3:122234436-122234458 CTTTAGAAAGTAATGGGCAAAGG - Intronic
960898917 3:122534526-122534548 CATTATATAGTGATATAAAAAGG - Intronic
961645554 3:128390958-128390980 CTTTAGATAGTGATCAGCAAAGG - Intronic
964314054 3:155424635-155424657 CTAAATATACAGATGGACAATGG + Intronic
964349644 3:155790249-155790271 TTTTATATAGTGTTAGATAAGGG - Intronic
970428758 4:15969169-15969191 CCTTGAATAGTGATGGACCATGG + Exonic
972236738 4:37143393-37143415 TTTTATATAGTGATAGATACAGG + Intergenic
974468499 4:62289048-62289070 CTTTATAAATTGCTGGAGAATGG + Intergenic
978164699 4:105592756-105592778 CTTTATGAAATGATGGAAAAGGG - Intronic
978529803 4:109702259-109702281 CTTTATATTTTGCTGCACAAAGG - Intronic
978994709 4:115136342-115136364 CAGTATATAGTGAAAGACAAGGG - Intergenic
979557022 4:122059938-122059960 TTTTATATAATGATGCACCAAGG + Intergenic
979834676 4:125349761-125349783 CGTTATATAAAGATGCACAAAGG + Intronic
982240436 4:153294943-153294965 CTTTAGGTGGTGATGGACATGGG + Intronic
987440134 5:17945440-17945462 CTTTTTATATTGATTGACATTGG - Intergenic
988105202 5:26737162-26737184 CTGTATCTAGTAATGGAGAAGGG - Intergenic
988258367 5:28850106-28850128 CTTTATATACTGCTGGCCTAGGG + Intergenic
988295024 5:29346782-29346804 TTTTATTTAGGGATGTACAAAGG - Intergenic
989519601 5:42385312-42385334 CTTTATGTTGTGGTGGAGAAAGG - Intergenic
991347709 5:65687569-65687591 CTTTCTATAGTGGTAGAAAAAGG - Intronic
991510671 5:67373519-67373541 CTTTATTTATTGATGGAAAGAGG - Intergenic
991525823 5:67556732-67556754 TTTTATATAGTGTGAGACAAGGG + Intergenic
992537534 5:77724536-77724558 CTTTATATAGTTATGGTATAAGG + Intronic
993921193 5:93805298-93805320 CTTTATATAGTGAAGGAGCAAGG - Intronic
994640532 5:102402882-102402904 CATTATATAGTAATTAACAATGG - Intronic
995159117 5:108954883-108954905 CTGTATATTCTGATGGACAGAGG + Exonic
995981001 5:118104183-118104205 CTTTATATGCTGAAGGAAAAAGG + Intergenic
996652684 5:125899635-125899657 CATTATATAGTGTTAGATAAAGG - Intergenic
997425986 5:133802999-133803021 CTTCATATAGTCAGGGAAAATGG - Intergenic
998098175 5:139409488-139409510 TTTTATTTAGTGAAGGAGAACGG - Intronic
998981673 5:147710645-147710667 GTTTATATAGTGCTGCATAAAGG + Intronic
1003464322 6:6364055-6364077 TTTTATATAGTGATCGTCAAGGG + Intergenic
1007323966 6:41046377-41046399 CTATAAATACTGATGGACAGAGG + Intronic
1010844790 6:80691992-80692014 ATTTAAATGGTGATGGACATTGG + Intergenic
1012308154 6:97685745-97685767 CTTTTAATAGCTATGGACAAAGG + Intergenic
1013833000 6:114297095-114297117 CTTTATAGAGAGATGGACAGAGG + Intronic
1014525626 6:122498247-122498269 CCTCATATGGTGGTGGACAAGGG + Intronic
1015328673 6:131952093-131952115 TTTTATATAGGCAAGGACAAGGG + Intergenic
1016803222 6:148187476-148187498 AATTAAATAGTGATTGACAATGG - Intergenic
1016964986 6:149710499-149710521 CTGAATATACAGATGGACAATGG - Intronic
1017393104 6:153962841-153962863 ATTTACATATGGATGGACAAGGG - Intergenic
1019787867 7:2990140-2990162 CTTAATATGGTGATGCACATTGG - Intronic
1019851025 7:3557500-3557522 CTTGATGTGGTGATGGACACAGG + Intronic
1020825641 7:13024755-13024777 CTTTATAGAGATATGAACAATGG - Intergenic
1024806204 7:53143739-53143761 CTTTACAAACTGAAGGACAAAGG - Intergenic
1026281900 7:68929479-68929501 CTGTATAGATTGATAGACAAGGG + Intergenic
1026811039 7:73465236-73465258 CTCTATATATAGATGGCCAAAGG + Intronic
1028367579 7:90052023-90052045 GTTTATATAGTGATGAAAGAGGG - Intergenic
1028817884 7:95168361-95168383 TTATATATAGTGAGGGATAAGGG - Intronic
1030467222 7:109918457-109918479 CTTTATTTAGTCATTGAAAATGG + Intergenic
1033298876 7:140167905-140167927 CCTTAAATATTGAGGGACAAAGG + Intronic
1034870485 7:154679146-154679168 CTGTGGATGGTGATGGACAAGGG - Intronic
1036009931 8:4710437-4710459 CTTTATATATTGATATATAATGG + Intronic
1037516215 8:19634517-19634539 CTTGATATGGTGATGCACACCGG + Intronic
1044258027 8:90088864-90088886 CTTTATGGACTCATGGACAAGGG - Intronic
1047076076 8:121405007-121405029 ATATGTATAGTGAGGGACAATGG - Intergenic
1050180844 9:2920996-2921018 CTTGATATCATGATGCACAAAGG - Intergenic
1052051496 9:23853440-23853462 CTTTATTTAGTCAGGGAAAATGG + Intergenic
1052454695 9:28681113-28681135 TTGTATATAGTGTTGGATAAGGG + Intergenic
1052916829 9:33929520-33929542 CTTTATGTATTGATGGAGAGTGG + Intronic
1053058741 9:35011691-35011713 CTTTATATCGTGTTGGGAAATGG - Intergenic
1055085455 9:72309030-72309052 CTCAATATAGGGATGGACCAAGG + Intergenic
1055708458 9:79033637-79033659 TTTTATTAAGTGATGGAAAAAGG + Intergenic
1056736826 9:89216944-89216966 CAGTACATAGTGATGGTCAAGGG + Intergenic
1058680891 9:107439340-107439362 CTTGGTATAGTGGGGGACAAAGG - Intergenic
1059890913 9:118802964-118802986 TTTTATATAGTATTGTACAAGGG - Intergenic
1060788279 9:126467630-126467652 CTTTATATTGGTATGGACTAGGG + Intronic
1186228550 X:7427964-7427986 CTTTAGATAGTGTTTGACGATGG + Intergenic
1187732579 X:22270874-22270896 CTTTGCATATTGATGGACACTGG + Intergenic
1188194760 X:27219527-27219549 ATTAATATAGTGATGAAAAATGG + Intergenic
1188657353 X:32715142-32715164 CTCTATATAGTTATACACAATGG + Intronic
1189239078 X:39511876-39511898 CTTTATTTAGAGAAGTACAAGGG + Intergenic
1190540443 X:51472227-51472249 CTTTATATAGTCATAGTCTATGG + Intergenic
1192005852 X:67211418-67211440 CTTTATATAAAGAAGGAGAAAGG + Intergenic
1195897115 X:109757756-109757778 TTGTATATAGTGAGAGACAAGGG - Intergenic
1196154992 X:112418927-112418949 CCTCATATATTGAAGGACAATGG + Intergenic
1196392810 X:115226658-115226680 CTATATCTAGTGAGGGACTAAGG - Intronic
1199338247 X:146644291-146644313 CTATATATAGATATGGACTAGGG - Intergenic
1199859660 X:151789882-151789904 CTATAGACAGAGATGGACAAAGG + Intergenic