ID: 952071068

View in Genome Browser
Species Human (GRCh38)
Location 3:29636478-29636500
Sequence ATGTGCGAGGGGAGGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 716
Summary {0: 1, 1: 0, 2: 3, 3: 42, 4: 670}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952071060_952071068 26 Left 952071060 3:29636429-29636451 CCAATAAATGGCTGTCACTAGAA 0: 1
1: 0
2: 0
3: 9
4: 102
Right 952071068 3:29636478-29636500 ATGTGCGAGGGGAGGGTGGAAGG 0: 1
1: 0
2: 3
3: 42
4: 670

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952071068 Original CRISPR ATGTGCGAGGGGAGGGTGGA AGG Intronic
900088227 1:908678-908700 AGGTGGGAGGGGAGAGGGGAGGG + Intergenic
900458973 1:2791115-2791137 AGGTGCGCGGGGAGGGTGCTGGG - Intronic
900491654 1:2952320-2952342 AGATGCTTGGGGAGGGTGGAAGG - Intergenic
900715657 1:4141839-4141861 ATGGTGGAGTGGAGGGTGGACGG + Intergenic
902758829 1:18567452-18567474 TTGTGTGAGGAAAGGGTGGAGGG - Intergenic
902931763 1:19736439-19736461 ACCTGGGAGTGGAGGGTGGATGG - Intronic
904024211 1:27492007-27492029 ATGGGTGAGGGAAGAGTGGAGGG - Intergenic
904336792 1:29802989-29803011 ATGTGAGAGGGGAGGGTCTTGGG + Intergenic
904498453 1:30900808-30900830 ATGGGGGAGGGCAGGATGGATGG + Intronic
904921513 1:34011856-34011878 TTGTGAGTGGGGAGGGAGGAGGG - Intronic
905180530 1:36162830-36162852 ATGTCCGATGGGTGGGTGGGTGG - Intronic
905406883 1:37739726-37739748 AGTTGCCAGGGGAGGGTGGTGGG + Intronic
905794034 1:40805427-40805449 ATGAGCAAGGGGAGAGTGGTGGG - Intronic
906135974 1:43501244-43501266 AAGGGAGAGGGGAGGGGGGAGGG - Intergenic
907651155 1:56296067-56296089 ATGTGTGAATGGAGAGTGGATGG - Intergenic
908146238 1:61247614-61247636 ATGTGTGAGGGGAGGTGAGAGGG + Intronic
908322478 1:62991730-62991752 AGGTGGGAGGTGGGGGTGGAGGG - Intergenic
908466943 1:64405553-64405575 ATGTGTGTGGGGAGGGTTGAAGG + Intergenic
908475487 1:64483861-64483883 ATATGCAAGGGGGGGGGGGAAGG - Intronic
908789828 1:67770457-67770479 ATGGTGGAGGGGAGGGTGAAAGG + Intronic
910623752 1:89284597-89284619 ATCTGCTAGGGCAGTGTGGAAGG + Intergenic
911376401 1:97056869-97056891 CTTTGCTAGGGCAGGGTGGAAGG + Intergenic
911737740 1:101355941-101355963 ATGCTCGAAGAGAGGGTGGAGGG + Intergenic
912945521 1:114081041-114081063 GTGTGCTGGGAGAGGGTGGAGGG + Intergenic
913433892 1:118827028-118827050 ATGAGAGAGGGGAGGATGAATGG - Intergenic
913439167 1:118879012-118879034 AGGTGCTGGGGGTGGGTGGAGGG + Intergenic
914992493 1:152510977-152510999 TTCTGGAAGGGGAGGGTGGAAGG + Exonic
915331700 1:155116736-155116758 ATGGGCGAGGGGAAGGTGACAGG - Intergenic
915360463 1:155283547-155283569 ATGGGTGGGGGGAGGGGGGAGGG - Intronic
915500999 1:156317619-156317641 ACGTGGGAGAGGTGGGTGGAAGG - Intronic
915878805 1:159643431-159643453 AAGGGGGAGGGGAGGGGGGAGGG + Intergenic
916564751 1:165964795-165964817 TTGGGTGAGGGGAGGGGGGAGGG - Intergenic
917749493 1:178041215-178041237 ATGGGGGAATGGAGGGTGGAAGG - Intergenic
917790563 1:178496385-178496407 AGGTGGGAGGGGAGGGCGCAGGG - Intergenic
918078964 1:181191151-181191173 ATGTTCTAGGGGAGACTGGAGGG + Intergenic
918216530 1:182396657-182396679 AGGTGGGAGGGGAGGGAGGAAGG - Intergenic
918539141 1:185608821-185608843 ACTTGAGAGGGGAGGGTGGGAGG + Intergenic
918916064 1:190639427-190639449 ATGTGCACTTGGAGGGTGGAGGG + Intergenic
918948622 1:191105470-191105492 ATCTGAGAGTGGAGGGTGGGAGG - Intergenic
919202396 1:194372715-194372737 ATGGGAGAGTGGAGGGTGGCAGG - Intergenic
919289726 1:195614169-195614191 TTGGGTGAGGGGAGGGGGGAAGG - Intergenic
920029844 1:203030275-203030297 AGGTGTGAGGTGAGGCTGGATGG + Intronic
920296803 1:204962750-204962772 AGGTGAGAGGGTACGGTGGATGG - Intronic
920377846 1:205518912-205518934 AGGTGGGAGGGGAGGTTGGCTGG + Intronic
921624199 1:217359956-217359978 TTGGGTGAGGGGAGGGGGGAGGG + Intergenic
922205295 1:223441151-223441173 ATGTGGGAGGGAGGAGTGGATGG + Intergenic
922433606 1:225581431-225581453 GAGTGGGAGTGGAGGGTGGAGGG + Intronic
924172663 1:241357505-241357527 CTGTGCGATGGGTGGGTGGGTGG + Intergenic
924268612 1:242308934-242308956 GTGTGGGAGGGGAGGATGGAAGG + Intronic
1063207569 10:3849110-3849132 AAGGGGGAGGGGAGGGGGGAAGG - Intergenic
1063350813 10:5352937-5352959 CTGTGTGTGGGGAGGATGGAGGG - Intergenic
1064088985 10:12367385-12367407 ATGGACGAGGGGTGGGGGGATGG + Intronic
1064193970 10:13230631-13230653 ATGTGCAAGAGGAGGCTGGGGGG + Intronic
1064225262 10:13478067-13478089 AGGGGAGAGGGGAGGGAGGATGG + Intronic
1065164169 10:22957405-22957427 CTGTGCGAGGGGTCAGTGGAAGG + Intronic
1066468268 10:35672047-35672069 ATGTGGGGGCGGGGGGTGGATGG + Intergenic
1066716293 10:38289834-38289856 GTGTGGGAGGGGAGGATGGAAGG - Intergenic
1066753413 10:38683861-38683883 ATTTGAGGGTGGAGGGTGGAAGG + Intergenic
1066934291 10:41805979-41806001 TGGGGTGAGGGGAGGGTGGAGGG + Intergenic
1066950243 10:42110747-42110769 ATGAGAGAAGGGAGGGAGGAAGG - Intergenic
1067225366 10:44372852-44372874 CTGTGGGATGGGATGGTGGAGGG - Intronic
1067411012 10:46064638-46064660 AAGTGGGAGAGTAGGGTGGAAGG - Intergenic
1068244306 10:54343639-54343661 ATTTGCGGGGGGAGGTGGGAGGG + Intronic
1069224748 10:65929017-65929039 GTGGGTGAGGGGAGGGGGGAGGG - Intronic
1071069006 10:81669887-81669909 ATGGGCGAGAGCAGAGTGGAGGG + Intergenic
1071204195 10:83255014-83255036 GTGGGGGAGGGGAGGGGGGAGGG - Intergenic
1072802781 10:98404992-98405014 GTGAGGGAGGGGAGGGAGGATGG + Intronic
1073077324 10:100832317-100832339 AGGTGCCAGGGGAGGGGGGGGGG + Intergenic
1073104955 10:101027257-101027279 GTGAGGGAGGGGAGGGTGGAGGG - Intronic
1073363386 10:102918066-102918088 ATGTGCGAGGGGAGGGGGCGTGG - Intergenic
1073592128 10:104767624-104767646 AAGTGGGAGGGGAAGGGGGAAGG - Intronic
1073734522 10:106330558-106330580 TTTTGGGAGGGGAAGGTGGATGG + Intergenic
1074627721 10:115211753-115211775 GTGGGTGAGGGGAGGGGGGAGGG - Intronic
1074758278 10:116644197-116644219 ATGTGCGGGTGGAGGGATGATGG - Intronic
1074866335 10:117546282-117546304 ATGGGCGATGGGAAGGTAGAGGG + Intronic
1074877586 10:117626127-117626149 GTGGGAGAGGGGAGGGTGAAAGG + Intergenic
1074881708 10:117664832-117664854 GTGTGCCAGGGGAGGAGGGATGG - Intergenic
1075023207 10:118966225-118966247 AGGTGCCAGGGGAGGGAGGCTGG + Intergenic
1075454945 10:122579070-122579092 ATGTGATATTGGAGGGTGGAGGG + Intronic
1075489977 10:122858403-122858425 TTGGGTGAGGGGAGGGGGGAGGG + Intronic
1076135138 10:128040484-128040506 CAGGGCGAGTGGAGGGTGGATGG + Intronic
1076214103 10:128679124-128679146 ATCTGGGAGGGGATTGTGGAGGG + Intergenic
1076257800 10:129042309-129042331 AGGAGAGAGGGAAGGGTGGATGG - Intergenic
1076368903 10:129939259-129939281 CTGGGAGAGGGGAGGGTGGAGGG - Intronic
1076371850 10:129960255-129960277 AAGTGCCCGGGGAGGTTGGAAGG - Intronic
1076522140 10:131087917-131087939 AGGAGCGAGGGGAGGGTGGCAGG + Intergenic
1076605553 10:131687081-131687103 AGGGGCCTGGGGAGGGTGGACGG - Intergenic
1076621049 10:131788439-131788461 AAGTGCGAGGTGAGGCTGGGAGG - Intergenic
1076815620 10:132913362-132913384 AAGTGGGAGGGGCGGGTGGGCGG + Intronic
1076884545 10:133255709-133255731 ATGTGACCGGGGAGGGTTGATGG - Intergenic
1077280824 11:1744632-1744654 ATGTGGGTGGGGGGGGTGGATGG + Intronic
1077806591 11:5596547-5596569 ATGGGGGAGGGGAAGGGGGAAGG - Intronic
1078170441 11:8925395-8925417 ATGTGGGAGGGAAGGGAGGCGGG + Intronic
1078989054 11:16626965-16626987 ATGTGAGACGGGAGGGAGGTGGG - Intronic
1079110228 11:17601273-17601295 ATGTGGCAGGAGAGGGTGCAGGG + Intronic
1082076571 11:47980336-47980358 ATGTGGGAGGGCTGGGCGGAGGG + Intergenic
1083018512 11:59481791-59481813 ATGTTACTGGGGAGGGTGGAAGG + Intergenic
1083901640 11:65646296-65646318 AAGTGCGAGCGGATGGTGGTGGG - Exonic
1083955699 11:65981776-65981798 ATGTGCGTGTTGAGGGTGGGGGG + Intergenic
1084545566 11:69813533-69813555 ATGTCAGATGGGTGGGTGGATGG + Intronic
1084596392 11:70119302-70119324 ATGGGTGATGGGTGGGTGGATGG + Intronic
1084785708 11:71440573-71440595 ATGGGTGATGGGAGGGTAGATGG + Intronic
1084933740 11:72576089-72576111 TTGTGCTTGGGGTGGGTGGAGGG - Intergenic
1086477834 11:87198542-87198564 AGGGGAGAGGGGAGGGAGGAGGG - Intronic
1086655172 11:89345574-89345596 ATGTGGGAGGGAAAGGTGCAGGG - Intronic
1087901735 11:103649102-103649124 AGGTGCTTGGGGAGGGAGGAAGG + Intergenic
1088570659 11:111220372-111220394 ACTTGAGAGTGGAGGGTGGAAGG - Intergenic
1088884955 11:113999057-113999079 TTGTACGTGGGGTGGGTGGAGGG + Intergenic
1089013215 11:115147060-115147082 GTATGCGTGGGGAGGGTGGTGGG + Intergenic
1090372801 11:126268584-126268606 AGGTGGGCGGGGAGGGTGGGAGG + Intronic
1090572981 11:128068142-128068164 CTGTGCTAGGGCAGTGTGGAAGG - Intergenic
1090892770 11:130941446-130941468 TGGTGTGAGGGGAGGGGGGAGGG - Intergenic
1091340773 11:134811664-134811686 ATGTGGGAGATGAGGGTGGCAGG + Intergenic
1091755431 12:3048199-3048221 ATGAGCGGGGTGAGGGTGGCTGG + Intergenic
1092545970 12:9451266-9451288 AGAAGCGAGGGGAGGATGGAGGG - Intergenic
1092867392 12:12775523-12775545 ATGTGTGAGGGCAGGGAGCACGG + Intronic
1093385765 12:18551428-18551450 ATGTGGGAGGGGAGGTAGGCAGG - Intronic
1094506981 12:31070802-31070824 AGAAGCGAGGGGAGGATGGAGGG + Intergenic
1095476473 12:42590929-42590951 GTGTGTGGGGGGAGTGTGGAGGG + Intergenic
1096108650 12:49015055-49015077 ATGGGCTAGGGGAGAGTGCAGGG + Intronic
1096418013 12:51430483-51430505 ATGTGTGAGGAGAGGGTGGAGGG - Intronic
1096950012 12:55458642-55458664 ACTTGAGAGGGGAGGGTGGGTGG + Intergenic
1096957081 12:55536993-55537015 TTGTGGGGGGGGAGGGGGGAGGG + Intergenic
1096984930 12:55749965-55749987 ATGTTCGCGGGAAGAGTGGAGGG - Exonic
1097197960 12:57254721-57254743 AGGAGCAAGGGCAGGGTGGAGGG - Exonic
1097710291 12:62910194-62910216 AGGAGAGAGGGGAGGATGGAAGG + Intronic
1099238237 12:80107942-80107964 ATTTGAGAGTGGAGGGTGGGAGG + Intergenic
1099494354 12:83327938-83327960 ATGAGCGAGAGGAGTGGGGAAGG + Intergenic
1099501472 12:83419133-83419155 CTGTGCTAGGGGAGTGTGAAAGG + Intergenic
1100565590 12:95790820-95790842 AGGTGCGAGGGGAGGAGGGCTGG - Intronic
1101103130 12:101414202-101414224 TGGGGTGAGGGGAGGGTGGAGGG + Intergenic
1101434435 12:104652894-104652916 ATGTGCGTAGGGAGTGTGTAGGG - Intronic
1101652525 12:106690607-106690629 AGGTTCTAGGGCAGGGTGGAAGG - Intronic
1102460433 12:113096625-113096647 ATGTGGCAGGGGAGGGAGGGAGG + Intronic
1102523203 12:113492283-113492305 CTGTGCTAGGGCAGTGTGGAAGG + Intergenic
1102867922 12:116388948-116388970 GTGTGTGGCGGGAGGGTGGAGGG - Intergenic
1102918588 12:116774765-116774787 AGGTCCGGGTGGAGGGTGGAGGG + Intronic
1103123369 12:118399574-118399596 TTGAGGGAGGGGAGGATGGATGG + Intronic
1103902376 12:124310062-124310084 ATGTGGGAGGCTGGGGTGGAAGG + Intronic
1104081416 12:125433661-125433683 ATGGGTGGGGGGAGGGGGGAGGG - Intronic
1104092404 12:125527294-125527316 ATGGAAGAGTGGAGGGTGGATGG - Intronic
1104092426 12:125527361-125527383 ATGGAAGAGTGGAGGGTGGATGG - Intronic
1104544425 12:129698576-129698598 AGGGGAGAGGGGAGGGGGGAGGG + Intronic
1104778459 12:131404863-131404885 ATGGGTGAGGGGTGGATGGATGG - Intergenic
1104896277 12:132166546-132166568 ATGAGGGATGGGTGGGTGGATGG - Intergenic
1105446473 13:20461900-20461922 TTGTGGGAGGAGAGGGTGGGAGG + Intronic
1106269280 13:28138476-28138498 AGGGGAGAGGGGAGGGAGGAGGG - Intergenic
1106508542 13:30392921-30392943 ATGTGCAAGGAAAGGGAGGAGGG - Intergenic
1107482329 13:40795121-40795143 ATGGGGGAGGGGAGGGGGAAAGG - Intronic
1107989589 13:45806562-45806584 ATGAGAGTGGGGAGGGTGGAAGG + Intronic
1108062914 13:46551626-46551648 ATGTGAGAGGGGAGGTTTGCGGG + Intergenic
1108563856 13:51674731-51674753 ATGTGGGTGGGGAGGGTGGAGGG + Intronic
1109169262 13:59075653-59075675 GTGTGCTAGGGCAGTGTGGAAGG - Intergenic
1110333566 13:74300481-74300503 GTGTGGTAGGGGTGGGTGGATGG + Intergenic
1110572280 13:77018907-77018929 AAGTTGGAGGTGAGGGTGGAGGG - Intronic
1110716018 13:78705043-78705065 ATCTGAGAATGGAGGGTGGAGGG + Intergenic
1112186848 13:97136021-97136043 ATGCGTGTGGGGAGGGTGAAGGG - Intergenic
1112327197 13:98449798-98449820 GTGTGGGGGGGGAGGGGGGAAGG + Intronic
1112430514 13:99346609-99346631 ATGTGGGAGGGGTGGGGTGAAGG - Intronic
1112441355 13:99426936-99426958 AGGAGGGAGGAGAGGGTGGAAGG + Intergenic
1112441375 13:99426991-99427013 AGGAGAGAGGGGAGGGTGGAAGG + Intergenic
1112441394 13:99427037-99427059 AGGAGGGAGGAGAGGGTGGAAGG + Intergenic
1112464929 13:99635474-99635496 ATGTGGAAGGGGAGGCTGAATGG - Intronic
1113536345 13:111069348-111069370 CTGTGGGAGGGGAGAGTGTAAGG + Intergenic
1113872036 13:113565438-113565460 ATGTCAGAGGGGAGGGTCGGAGG - Intergenic
1113934916 13:113988899-113988921 ATGGGCGAGTGATGGGTGGATGG - Intronic
1114055810 14:18966277-18966299 TTGTGTGGGGGGAGGGGGGAGGG - Intergenic
1114106737 14:19435485-19435507 TTGTGTGGGGGGAGGGGGGAGGG + Intergenic
1114479426 14:23023158-23023180 ATGTGGGGGAGGAGGGAGGAAGG - Intronic
1114906702 14:27137290-27137312 ATGTGGGGGGGGGGGGTGGTGGG + Intergenic
1115012871 14:28572232-28572254 ATGTGCGATGGGGGTGTGGCTGG + Intergenic
1115193262 14:30769686-30769708 ATATGTGTGGGGAGAGTGGAGGG - Intergenic
1115755901 14:36525557-36525579 GGGTGTGAGGGAAGGGTGGAGGG + Intergenic
1115860558 14:37681628-37681650 ATGTCTGAGGGCAGGGGGGATGG - Intronic
1116632657 14:47355131-47355153 ATGTGCGAGGGTAAGCTGGTGGG - Intronic
1116641239 14:47466163-47466185 ATGTGAGGGTGGAGGGTGGGAGG + Intronic
1117717770 14:58598379-58598401 AGGTGGGAGGCGAGGGTGGGAGG + Intergenic
1118171774 14:63395704-63395726 AGGGGGGAGGAGAGGGTGGAAGG + Intronic
1118348225 14:64955228-64955250 GTGTGGGCGGGGAGGGAGGAAGG - Intronic
1118441744 14:65818516-65818538 TTGTGTGTGGGGAGGGTGGGGGG - Intergenic
1119692403 14:76685848-76685870 ATATGTGGGGGGAGGGGGGAAGG + Intergenic
1120045064 14:79796453-79796475 AAGAGAGAGGGGAGGGAGGAAGG - Intronic
1120854786 14:89203082-89203104 ATGTGGGGGGGGTGGGGGGAGGG + Intronic
1121237585 14:92403829-92403851 ATGTGCCAGGGTGGGGGGGAGGG - Intronic
1121491328 14:94363472-94363494 ATGTGCTAGGCCAGGATGGAGGG - Intergenic
1121618482 14:95330102-95330124 AGCTGGGAGGGAAGGGTGGAGGG + Intergenic
1122323432 14:100868756-100868778 AAGTGCGTGGGGTGGGTGGTGGG + Intergenic
1122408916 14:101516294-101516316 TGGTGGGAGGTGAGGGTGGAAGG - Intergenic
1122931224 14:104933766-104933788 CTGAGTGAGGGGAGGGTGGGAGG + Exonic
1122931307 14:104933971-104933993 CTGAGTGAGGGGAGGGTGGGAGG + Exonic
1122958307 14:105083056-105083078 ATGATGGAGGGGTGGGTGGAGGG - Intergenic
1123148947 14:106163145-106163167 GTGTGAGAGAGGAGGGAGGAAGG + Intergenic
1124373628 15:29117008-29117030 TTGTGGGAGGGGAGGTGGGAGGG + Intronic
1124461641 15:29897444-29897466 CTGTGCTAGGGCAGTGTGGAAGG + Intronic
1126293974 15:47116632-47116654 GTGTGAGAGGGGAGGTGGGATGG - Intergenic
1126455299 15:48855026-48855048 ATGTGAGAGTGAAGGGTGGGAGG + Intronic
1127283009 15:57508179-57508201 TGGGGCGGGGGGAGGGTGGAGGG - Intronic
1127670228 15:61187941-61187963 GTGTGTTAGGGGAGGGTTGAGGG - Intronic
1128156814 15:65396468-65396490 ATATGGGAGGGCAGGGAGGAAGG - Intronic
1128215666 15:65932603-65932625 ATGTGCTAGGGGTGGCTGAAGGG + Intronic
1128227057 15:66009336-66009358 ATGGGGGTGGGGAGGGTGCAGGG + Intronic
1128363454 15:66979561-66979583 ATGAGAAAGGGGAGGGAGGAAGG - Intergenic
1128509356 15:68303884-68303906 ATCTGCAAGGGGAGGGGGGCCGG + Exonic
1128542178 15:68543807-68543829 GTGTGCGTCAGGAGGGTGGAGGG - Intergenic
1128690259 15:69719312-69719334 ATGAGCAAGTGGAGGCTGGATGG + Intergenic
1128777176 15:70329412-70329434 ATGTCCAAGGGGAGGGAGGAGGG - Intergenic
1129508792 15:76104735-76104757 ATGTGTGAGGAGAGGGGAGAAGG + Intronic
1129912871 15:79242589-79242611 AGGAGTGAGGGGAGGGTTGACGG + Intergenic
1129955644 15:79634399-79634421 ATTTGGGAGGGCAGGGTGGGTGG + Intergenic
1130677839 15:85969453-85969475 ATGTGTGAGGAAGGGGTGGATGG - Intergenic
1131109273 15:89754631-89754653 ATGGGCGAGGGGTGAGTGGAGGG - Intergenic
1131556518 15:93404395-93404417 ATCTGCTAGGGCAGTGTGGAAGG + Intergenic
1131743636 15:95421292-95421314 ATCTGCTAGGGCAGTGTGGAAGG - Intergenic
1133512023 16:6468938-6468960 ATCTGAGGGTGGAGGGTGGAAGG - Intronic
1134523155 16:14927718-14927740 AGGGGCTAGGGGAGGGGGGAGGG - Intronic
1134549475 16:15132340-15132362 AGGGGCTAGGGGAGGGGGGAGGG + Intronic
1134710822 16:16326369-16326391 AGGGGCTAGGGGAGGGGGGAGGG - Intergenic
1134826188 16:17286279-17286301 ATGTGGGAGGAGTGGGTGGGAGG + Intronic
1134948779 16:18342276-18342298 AGGGGCTAGGGGAGGGGGGAGGG + Intergenic
1135726537 16:24858440-24858462 ATGAGTGAGTGGATGGTGGATGG + Intronic
1135737140 16:24940758-24940780 ATGTGGCTGGAGAGGGTGGAAGG + Intronic
1135892693 16:26371685-26371707 GTGGGGGAGGGGAGGGAGGAAGG + Intergenic
1136607835 16:31348461-31348483 ATGGGTGATGGGAGGGTGGATGG + Intergenic
1136681277 16:31964437-31964459 GTGTGAGAGAGGAGGGAGGAAGG - Intergenic
1136729295 16:32393130-32393152 ATTTGAGGGTGGAGGGTGGAAGG - Intergenic
1136781589 16:32905949-32905971 GTGTGAGAGAGGAGGGAGGAAGG - Intergenic
1136888204 16:33947891-33947913 GTGTGAGAGAGGAGGGAGGAAGG + Intergenic
1136956203 16:34789413-34789435 ATTTGGGAGGGCAAGGTGGAAGG - Intergenic
1138350794 16:56345292-56345314 ATGTGCCATGGGAGGGAGGAGGG + Exonic
1138358552 16:56406029-56406051 AGGGGAGAGGGGAGGGGGGAGGG + Intronic
1138390035 16:56663350-56663372 ATGTGCGGGGCGGGGGGGGAGGG - Intronic
1138544357 16:57706856-57706878 AGGAGAGAGGGGAGGATGGATGG - Intronic
1138750920 16:59420194-59420216 ACTTGGGAGGGGAGGCTGGAAGG - Intergenic
1139191532 16:64869126-64869148 ATGTGAGAGGGGAGAGAGGGTGG - Intergenic
1139431805 16:66914767-66914789 ATGAGTGATGGGAGGTTGGATGG + Intronic
1139691425 16:68644545-68644567 TGGGGCGGGGGGAGGGTGGAGGG - Intronic
1140068310 16:71627760-71627782 GTGAGCTAGGGGAGGGTGGGGGG + Intronic
1140517407 16:75553978-75554000 ATGTGATAGGGGATGGTGGGAGG - Intronic
1141314319 16:82946260-82946282 ATGTGGGAGGGAAGGGTGGAAGG + Intronic
1141585023 16:85027981-85028003 AGGGGCGCGGGGAGGGAGGAGGG + Intronic
1202997101 16_KI270728v1_random:124391-124413 ATTTGAGGGTGGAGGGTGGAAGG + Intergenic
1203023788 16_KI270728v1_random:436733-436755 ATTTGAGGGTGGAGGGTGGAAGG + Intergenic
1203084244 16_KI270728v1_random:1169931-1169953 GTGTGAGAGAGGAGGGAGGAAGG - Intergenic
1144037709 17:11382320-11382342 CTTTGGGAGGGGAAGGTGGAAGG - Intronic
1144159003 17:12538694-12538716 AGGTGGGAGTGGAGTGTGGATGG + Intergenic
1144399650 17:14883873-14883895 ATCTGCTAGGGCAGTGTGGAAGG - Intergenic
1144556353 17:16286108-16286130 ATGGGCCAGAGGTGGGTGGAGGG + Intronic
1145266202 17:21380719-21380741 ATGTCCAAGGGAAGGTTGGATGG - Intronic
1145825973 17:27877614-27877636 AAGTCAGAGGGCAGGGTGGAAGG + Intronic
1146296358 17:31653648-31653670 AGGGGAGAGGGGAGAGTGGAAGG - Intergenic
1146433975 17:32825534-32825556 ATTTGAGAGGCGAAGGTGGATGG - Intronic
1146655331 17:34631633-34631655 ATCTCAGAGGGGTGGGTGGAGGG - Intronic
1146688406 17:34856856-34856878 ATGGGGGTGGGGAGGATGGAGGG + Intergenic
1147044923 17:37744926-37744948 GTGCGAGAGAGGAGGGTGGAGGG + Exonic
1147139207 17:38452150-38452172 AGGTGGGAGGGGAGGGGGAAGGG - Intronic
1148460954 17:47838720-47838742 CTGTGGGAGGGGAGAGTGGCTGG + Intronic
1148640776 17:49185595-49185617 CTCTGCGAGGGGAGTGAGGAAGG + Intergenic
1148647236 17:49225991-49226013 TTGTTGGAGGGGAGGGTGGTAGG + Intronic
1148652730 17:49261193-49261215 ATGTGTGTGGGGAGTGTGGGTGG - Intergenic
1148688520 17:49513707-49513729 GAGGGCGAGGGGAGGGTGGCAGG + Exonic
1148722448 17:49763788-49763810 AAGTGTGAGGGGAAAGTGGATGG - Intronic
1148806897 17:50268503-50268525 CTGTGGGCCGGGAGGGTGGAGGG - Intergenic
1148839186 17:50483824-50483846 ATGTGTGTGGGGGGGGTGGCAGG - Intronic
1149126856 17:53245126-53245148 GTGTGCGGGGGGAGGGAGGTGGG - Intergenic
1149431074 17:56595932-56595954 AGGGGCGGGGGGAGGGTGGGCGG + Intergenic
1149477725 17:56977173-56977195 AAGGGCGAGGGGAGGGAGAAAGG + Intergenic
1149782211 17:59407079-59407101 ATCTGAGAGAGGAGGCTGGAGGG + Intergenic
1150217293 17:63477681-63477703 CCGGGCGAGTGGAGGGTGGATGG - Intergenic
1150219479 17:63487936-63487958 AAGTGTGAGGGGAGGCTGGCCGG + Intronic
1150542027 17:66111703-66111725 ACTTGAGAGGGGAGGGTGGGAGG + Intronic
1151422794 17:74009625-74009647 AGGCGGGAGGTGAGGGTGGAGGG - Intergenic
1152425611 17:80217006-80217028 AGGTGCAAGGGGCGGGAGGAGGG - Intronic
1152526424 17:80890534-80890556 GGGTGGGAGGGGCGGGTGGAGGG + Intronic
1152607656 17:81301068-81301090 ATGTGTGTGGTGTGGGTGGATGG + Intergenic
1153475522 18:5494651-5494673 TTGGGTGGGGGGAGGGTGGATGG - Intronic
1154092589 18:11379077-11379099 GTGTCCGAGGGTGGGGTGGAGGG - Intergenic
1154950436 18:21204388-21204410 ATGTGCGTGGTGAGGGTAGGGGG + Intergenic
1155046249 18:22105959-22105981 ATGTGAAAGGGGAGAGTGGAAGG - Intergenic
1155103004 18:22632316-22632338 ATTTGCTAGGGAAAGGTGGAAGG - Intergenic
1156134927 18:34026269-34026291 GTGTGCATGGGGAGGGAGGAGGG - Intronic
1156505038 18:37585108-37585130 GTGTGTGAGGGCAGGGTGGGAGG + Intergenic
1157264745 18:46208709-46208731 ATCTGGGAGGTCAGGGTGGATGG - Intronic
1157393519 18:47323036-47323058 TTGAGAGAGGGGAGGGTGGGTGG - Intergenic
1157409240 18:47449724-47449746 ATGTGGGGGGGGGGGGTGAAGGG - Intergenic
1157570036 18:48706125-48706147 ATGAGAGAGGGACGGGTGGAGGG - Intronic
1159775882 18:72602266-72602288 ATAAGGGAGGGGATGGTGGACGG + Intronic
1160392649 18:78546907-78546929 ATGGGGGAGGAGAGGGTGGAGGG + Intergenic
1160392658 18:78546926-78546948 AGGGGGGAGGAGAGGGTGGAGGG + Intergenic
1160392667 18:78546945-78546967 AGGGGGGAGGAGAGGGTGGAGGG + Intergenic
1160714605 19:570622-570644 AGGGGCGAGGGGTGGGTGGGAGG + Intergenic
1160977773 19:1802246-1802268 ATGAGTGGGGGGTGGGTGGATGG - Intronic
1161022361 19:2016059-2016081 AGGTGGGAGGGGAGGAGGGAGGG + Intronic
1161346836 19:3772343-3772365 AGGAGGGAGGGCAGGGTGGATGG + Intergenic
1161388483 19:4009137-4009159 ATGTGAAAGGGGATGGGGGAGGG - Intronic
1161609249 19:5231786-5231808 AGGTGGGATGGGCGGGTGGATGG + Intronic
1161657652 19:5525793-5525815 GTGAGGGAGGGGAGGATGGATGG - Intergenic
1161668514 19:5591063-5591085 ATGTGCCAGGGTCGGGGGGATGG - Intronic
1162765013 19:12913911-12913933 ATGTGCGAGGAGAGGGAAGCTGG + Intronic
1162958242 19:14111810-14111832 CAGTGGGTGGGGAGGGTGGAGGG + Intronic
1163007722 19:14406959-14406981 AGGTGAGAGGAGAGGCTGGAAGG + Exonic
1163225927 19:15961283-15961305 ATGTGCTAGGGCAGTGGGGAGGG + Intergenic
1163696366 19:18765527-18765549 AGGTGCGAGGGCAAGGTGGGGGG + Exonic
1164326964 19:24202293-24202315 TTGGGTCAGGGGAGGGTGGAGGG + Intergenic
1164734250 19:30529029-30529051 AAGGGCGAGGGGAGGGGTGAAGG + Intronic
1165313490 19:35041684-35041706 CTGGGCGAGGGGCGGGTGAAGGG - Intronic
1165610366 19:37146425-37146447 ATTTGAGAGCTGAGGGTGGAGGG + Intronic
1165793564 19:38506188-38506210 TTGAGCCAGGGGAGGGTGGAGGG + Intronic
1166732822 19:45068315-45068337 TTGTGCGGGGGGGGGGTGGGGGG - Intronic
1166786515 19:45370426-45370448 GGGGGCGAGGGGAGGGTGAAGGG - Intronic
1167261770 19:48462806-48462828 CTTTGCGAGGGGGTGGTGGAGGG + Intronic
1168296637 19:55380291-55380313 AGGGGGGAGGGGAGGGGGGAAGG - Intronic
1168547021 19:57261319-57261341 ATGTGGGAGGGGTGGGGAGAAGG + Intergenic
1168591001 19:57634102-57634124 ATCTGTCTGGGGAGGGTGGAGGG - Intronic
924963720 2:57321-57343 CTGTGCAAGGGTAGGGTGCAGGG - Intergenic
925011460 2:488649-488671 AACTGCGAGGGCAGGGTGGGTGG - Intergenic
925418401 2:3690314-3690336 AGGGGGGAGGGGAGGGGGGAGGG - Intronic
925418409 2:3690326-3690348 AGGGGGGAGGGGAGGGGGGAGGG - Intronic
925927090 2:8678494-8678516 TGGCGCGAGGGAAGGGTGGATGG - Intergenic
925927599 2:8681696-8681718 ATGGGGGAGGGGAAGGGGGAGGG - Intronic
926499902 2:13641215-13641237 ATCTGCCAGGGGAGGGCAGAGGG + Intergenic
927605647 2:24484044-24484066 CTCTGCTAGGGCAGGGTGGAAGG + Intergenic
928945076 2:36764875-36764897 ATGTCAAAGGGGAAGGTGGATGG + Intronic
929023412 2:37576192-37576214 ACCTGAGAGGGGAGGGTGGGAGG - Intergenic
929193272 2:39159763-39159785 ATGTGGGAGGCGAAGGTTGAAGG + Intergenic
929216924 2:39424345-39424367 AGGTGGGAGGGGATGGAGGAAGG + Intronic
930639513 2:53840578-53840600 AGGGGAGAGGGGAGGGGGGAGGG + Intergenic
930752172 2:54944981-54945003 ATGGGGGAGGGGAGGGAGAAAGG - Intronic
931372006 2:61672298-61672320 CTGGGTGAGGGAAGGGTGGATGG + Intergenic
931779689 2:65568345-65568367 ATTTGAGGGTGGAGGGTGGAAGG - Intergenic
931884377 2:66599769-66599791 AAGAGCAAGGAGAGGGTGGAAGG - Intergenic
932006263 2:67930182-67930204 ATGTGTGGGTGAAGGGTGGATGG + Intergenic
932222486 2:70010396-70010418 ATTTGCGTGGCAAGGGTGGAGGG + Intergenic
932433053 2:71686831-71686853 GGGTGGGCGGGGAGGGTGGACGG + Intergenic
932502459 2:72195367-72195389 ATGTTCAAGGGGAGGATGGGAGG + Intronic
933820186 2:86104190-86104212 AGGTGTAAGGGGAGGGTGGAAGG + Intronic
933864131 2:86500508-86500530 CTCTGCGAGGGCAGTGTGGAGGG - Intergenic
934185595 2:89671041-89671063 ATTTGAGGGTGGAGGGTGGAAGG - Intergenic
934331824 2:92075314-92075336 ATGAGAGAAGGGAGGGAGGAAGG + Intergenic
934575366 2:95397241-95397263 ATGTGGGAGGGGCAGCTGGAGGG + Intergenic
935407954 2:102728739-102728761 ATGTCCGAGGTCATGGTGGAAGG - Intronic
935517597 2:104061497-104061519 ATGGGTGGGGGGAGGGGGGAGGG - Intergenic
935684981 2:105675160-105675182 ATGGGCGCAGGGAGGGTGGATGG - Intergenic
935867905 2:107411183-107411205 AGGAGCGAGGGGAGGGAAGAGGG - Intergenic
936644624 2:114354819-114354841 ATGTGTGTGGGGTTGGTGGATGG - Intergenic
936909410 2:117574991-117575013 ATCTGCCAGGGCAGTGTGGAAGG - Intergenic
937159614 2:119747590-119747612 AGCTGGGTGGGGAGGGTGGAAGG + Intergenic
937546069 2:123022425-123022447 ATTTGCGGGGGAAGAGTGGAAGG + Intergenic
938516120 2:132009493-132009515 ATGAGAGAAGGGAGGGAGGAAGG - Intergenic
939334369 2:140806506-140806528 AGGTGTGAGTGAAGGGTGGAGGG + Intronic
939382143 2:141448852-141448874 ATGTGTGAGGATTGGGTGGATGG - Intronic
940154697 2:150643197-150643219 GTGTGCTGGGGGAGGATGGAGGG - Intergenic
940602434 2:155878627-155878649 TGGGGTGAGGGGAGGGTGGAGGG + Intergenic
941038188 2:160590504-160590526 AAGGGGGAGGGGAGGGGGGAGGG - Intergenic
941673800 2:168322601-168322623 AGGTGGGTGGGGAGGGTGAAAGG + Intergenic
942387842 2:175460896-175460918 ATCTGCTAGGGCAGTGTGGAAGG + Intergenic
943231907 2:185264744-185264766 ATCTGCTAGGGCAGTGTGGAAGG - Intergenic
943645047 2:190401084-190401106 AGGAACAAGGGGAGGGTGGAGGG + Intergenic
943688342 2:190842926-190842948 AAATGCATGGGGAGGGTGGATGG + Intergenic
943967666 2:194357988-194358010 AGGTGGGAGGGAAGTGTGGATGG + Intergenic
944290438 2:197998401-197998423 ATGTGTGAGGGGTGTGTGTAGGG + Intronic
944687180 2:202127960-202127982 AGGGGCTAGGGGAGGGAGGAGGG - Intronic
944925426 2:204459093-204459115 ATGGGAGAGGAGAGGGTGGGAGG - Intergenic
945349248 2:208758240-208758262 TGGGGTGAGGGGAGGGTGGAGGG - Intronic
946295751 2:218782276-218782298 TTGTCCGAGGGGAGGGCGGCAGG - Exonic
946431447 2:219628947-219628969 GAGTGGGAGGAGAGGGTGGATGG - Intronic
946716035 2:222556328-222556350 AAGCGTGAGGGGATGGTGGAGGG + Intronic
947744622 2:232501224-232501246 ATGTGCCAGGGGCAGGGGGAAGG - Intergenic
947744858 2:232502253-232502275 ATGGGGGAGGGGTGGGAGGAGGG + Intergenic
948155306 2:235776719-235776741 GTGTGCAAGGGGAAGGGGGAGGG - Intronic
948456777 2:238108185-238108207 CTGCGCGAAGGGAGGGAGGATGG - Intronic
948481238 2:238251842-238251864 ATGAGTGGGGTGAGGGTGGAGGG + Intronic
1168927911 20:1598159-1598181 ATGTGGCAGGGGAGGAGGGAAGG + Intronic
1169138645 20:3213651-3213673 ATGTGTGTGGGGAGGATGTAGGG - Intronic
1169178360 20:3539746-3539768 AAGTGGGAGGGGGCGGTGGAGGG - Intronic
1170747229 20:19111071-19111093 GTGTGTGTGGGGAGGGGGGAGGG + Intergenic
1171026659 20:21636924-21636946 AGGTGTGGGGGGAGGGGGGAGGG + Intergenic
1171143943 20:22765685-22765707 ATGTGCCTGGGGTGGGAGGAGGG + Intergenic
1171214017 20:23339123-23339145 ATGGTAGAGAGGAGGGTGGAAGG - Intergenic
1171307028 20:24115548-24115570 AGGTGCGAGGGGTGGATGCAGGG - Intergenic
1171896337 20:30813552-30813574 CTTTGCCAGGGTAGGGTGGAGGG + Intergenic
1172301380 20:33852875-33852897 TTGTGCGAGGGGATGGGGGAAGG - Intronic
1172301545 20:33853742-33853764 ATGGGCGGGGGGAGGGGGGCGGG + Exonic
1172338484 20:34136359-34136381 CTCTGCGAGGGGAGTGTGGCGGG - Intergenic
1172845880 20:37929789-37929811 ATGTGGGAAGGGAGAGTGGAGGG + Intronic
1173155281 20:40603252-40603274 ATGAGGGAAGGGAGGGAGGAGGG + Intergenic
1174568035 20:51481075-51481097 TTGTAGGAGGGGAGGATGGAGGG - Intronic
1174651580 20:52130149-52130171 AAGTGCCATGGCAGGGTGGAGGG - Intronic
1174736349 20:52969383-52969405 ATGGACCAGGGCAGGGTGGATGG + Intergenic
1175097284 20:56551686-56551708 AGCTGGGAGGGGAGGGTGTACGG + Intergenic
1175296729 20:57913740-57913762 ATGTGCATGGGCAGGGTGGACGG + Intergenic
1175388388 20:58611542-58611564 AGGTGCCAGGGGAGGGAGGTGGG + Intergenic
1175430622 20:58900066-58900088 ATCTGAGGGGGGAGGGGGGATGG + Intronic
1175541695 20:59751827-59751849 ATATCCGAGACGAGGGTGGAAGG - Intronic
1175797008 20:61778081-61778103 AAGATAGAGGGGAGGGTGGAGGG - Intronic
1175817265 20:61889780-61889802 ATGGGTGAGTGGATGGTGGATGG + Intronic
1175817331 20:61890124-61890146 ATGGGTGAGTGGATGGTGGATGG + Intronic
1176678172 21:9800780-9800802 ATTTGTGTGGGGATGGTGGAAGG + Intergenic
1177024029 21:15899275-15899297 ACTTGAGAGGGGAGGGTGGAAGG - Intergenic
1177447582 21:21217783-21217805 ATGCAGAAGGGGAGGGTGGAGGG + Intronic
1178016379 21:28351126-28351148 ATGCGGGAGGAGAGGGAGGAAGG - Intergenic
1178127471 21:29530597-29530619 ATGGGAGAGGAGAGGGTTGAAGG + Intronic
1179125506 21:38587297-38587319 ATGTTCAAGGGGATGGGGGAGGG + Intronic
1179535065 21:42046100-42046122 ATGGGCGAGGGGAGGTGGGGGGG + Intergenic
1179649526 21:42798423-42798445 GGGTGGGAGGGGAGGGTGGGGGG + Intergenic
1180474289 22:15688830-15688852 TTGTGTGGGGGGAGGGGGGAGGG - Intergenic
1180590166 22:16930604-16930626 AAGGGCAAGGGGAGTGTGGATGG + Intergenic
1181371776 22:22424741-22424763 ATGTGGGAGGGGAGAGGGTAAGG - Intergenic
1181877079 22:25948079-25948101 ATGATCGATGGGTGGGTGGATGG - Intronic
1182036371 22:27201565-27201587 ATGTGAGATGGGAGAGTAGAGGG - Intergenic
1182253165 22:29018071-29018093 GTGTGGGAGGGGAGGGCGGACGG + Intronic
1182302129 22:29342860-29342882 ATGTGGCAGGGGCCGGTGGAGGG - Intronic
1183093335 22:35538444-35538466 AAGTGGGTGGGGAGGGGGGAAGG + Intergenic
1183624193 22:38991787-38991809 ATGGGCCCGGGGAGGGTGGCTGG + Intronic
1183688573 22:39375759-39375781 CAGTGAGAGGGGAGGATGGAGGG - Intronic
1183716468 22:39536094-39536116 ATGGGCTAGGGGAGGGAGGGCGG - Intergenic
1184210862 22:43034906-43034928 AGGGGGGAGGGGAGGGGGGAGGG + Intergenic
1184713241 22:46265468-46265490 CTGTGCTAGGGCAGTGTGGAAGG - Intergenic
1184744631 22:46449174-46449196 ATGTGTGATGGGTGGTTGGATGG - Intronic
1184744666 22:46449346-46449368 ATGTGTGATGGGTGGTTGGATGG - Intronic
1184744673 22:46449377-46449399 ATGTGTGATGGGTGGTTGGATGG - Intronic
1184835743 22:47019955-47019977 AAGGGAGAGGGGAGGATGGAGGG - Intronic
1184835752 22:47019980-47020002 AAGGGAGAGGGGAGGATGGAGGG - Intronic
1184852342 22:47128055-47128077 ATGGGTGAGGGGAGGGGGGATGG - Intronic
1184944590 22:47794114-47794136 AGGTGTGAAGGGAGGGAGGAAGG - Intergenic
1185068019 22:48641635-48641657 GTGTGTGAGGGGAGGGTGTGCGG - Intronic
1185330022 22:50248345-50248367 AGGTGCGAGGGGAGGTAGGGCGG - Exonic
949491212 3:4590874-4590896 TTGTGGAGGGGGAGGGTGGAAGG - Intronic
949751969 3:7362882-7362904 ATTTGCGAGGCCAGGGTGGAAGG + Intronic
949865048 3:8540598-8540620 AGGTGGGAGGGGAGGCAGGAAGG + Intronic
950047395 3:9957635-9957657 TTGTGGGAGGGGAGGGAGCAGGG - Intergenic
950518608 3:13483087-13483109 AAGGGCGGGGGGAAGGTGGAGGG + Intronic
951711002 3:25584842-25584864 ATGTGAGATGGCAGAGTGGAGGG + Intronic
951874062 3:27401219-27401241 ATGTGCTATGGGGGAGTGGAGGG - Intronic
952071068 3:29636478-29636500 ATGTGCGAGGGGAGGGTGGAAGG + Intronic
952192967 3:31043197-31043219 GTCAGGGAGGGGAGGGTGGAGGG - Intergenic
952767560 3:36968150-36968172 ATGGGGTAGGGGAGGGGGGAGGG - Intergenic
953880111 3:46687037-46687059 ATGGGCGAGTGGCTGGTGGAGGG + Exonic
954501346 3:51019620-51019642 CTGTTGGAGGTGAGGGTGGAAGG - Intronic
955895039 3:63689890-63689912 TTGGGTGAGGGGAGGGGGGAGGG + Intergenic
956365481 3:68497506-68497528 ATGTCAGTTGGGAGGGTGGAAGG + Intronic
956474978 3:69610156-69610178 ATCTGCTAGGGCAGTGTGGAAGG + Intergenic
956659549 3:71583994-71584016 ATGTCGGGGGGGAGGGGGGAGGG - Intergenic
956737247 3:72247271-72247293 GCGTGGGTGGGGAGGGTGGAAGG - Intergenic
957084466 3:75667730-75667752 AGGTGGGGGGGGAGGGAGGAAGG + Intergenic
957085358 3:75672088-75672110 TTTGGCGAGGGTAGGGTGGAGGG + Intergenic
957987468 3:87590136-87590158 ATCTGCTAGGGCAGTGTGGAAGG - Intergenic
958061258 3:88484500-88484522 ATATGGGAGTGGAGGATGGATGG + Intergenic
958880285 3:99661941-99661963 ATGTGCCAGGGGATGAGGGAAGG + Intronic
959031805 3:101308303-101308325 ATCTGCTAGGGCAGTGTGGAAGG - Intronic
959916643 3:111823870-111823892 ATGTGTGAGGAGATGGTGGAGGG + Intronic
960435200 3:117618212-117618234 ATTAGAGAGGGGAGGGTGGGAGG + Intergenic
961431465 3:126886910-126886932 AGGGGTGAAGGGAGGGTGGAAGG - Intronic
961524440 3:127487647-127487669 AGGTGTGAGGGGAGGGTGGGGGG - Intergenic
961739288 3:129022658-129022680 GGGTGTGAGGGGAGGGTGGGTGG + Intronic
961746095 3:129064312-129064334 CTGTGGGTGGAGAGGGTGGAGGG + Intergenic
962047931 3:131780664-131780686 ATTTGAGAGTGGAGGGTGGGAGG + Intronic
962073527 3:132056610-132056632 TTGGGTGAGGGGAGGGGGGAGGG - Intronic
962470326 3:135702064-135702086 ATTTGAGAGTGGAGGGTGGGAGG + Intergenic
962763765 3:138542592-138542614 AGGTGCCAGTGGAGGGTGGGAGG + Intronic
962973310 3:140424872-140424894 CTGTGGTAGGGGAGGGTGGGTGG + Intronic
963826900 3:149965697-149965719 ATGTGCGAAGGGAGGGGGGGCGG + Exonic
963892716 3:150653589-150653611 ATGTGCGGGTGGAGGGAGGAGGG - Intergenic
964460086 3:156914935-156914957 ACTTGAGAGTGGAGGGTGGAAGG - Intronic
965373891 3:167897614-167897636 AGGAGGGAGGGGAGGGGGGAGGG + Intergenic
965373905 3:167897638-167897660 AGGAGGGAGGGGAGGGGGGAGGG + Intergenic
965384222 3:168026615-168026637 ATGTGCATGGGGTGGGAGGAAGG - Intronic
965871401 3:173269534-173269556 ATGTGGAAGGGGATGGTTGAAGG + Intergenic
966686431 3:182700945-182700967 ATGTGCAAGGGTAGGGTGTGAGG - Intergenic
967072423 3:185973296-185973318 ATGAGGGAGGGGAGGGTAGTAGG + Intergenic
968768073 4:2485049-2485071 ATGTGGGTGGGGTGGGCGGAAGG - Intronic
969583386 4:8078326-8078348 GTGTGCGTGGGGAGAGGGGATGG - Intronic
969704628 4:8785033-8785055 TTGTGGGAAGGGTGGGTGGAGGG - Intergenic
969971324 4:11051422-11051444 AGGTGCGAGGGCAGGGAGGAAGG - Intergenic
971531840 4:27698470-27698492 TTGGGTGGGGGGAGGGTGGAGGG - Intergenic
972147324 4:36043842-36043864 AGGGGGGAGGGGAGGGGGGAGGG + Intronic
972587263 4:40449353-40449375 ATGAGCGAGGGGTGGGCAGAAGG - Intronic
972671099 4:41214624-41214646 CTGCGCGAGGGAAGGCTGGAGGG + Intronic
972776966 4:42250358-42250380 AGTTGCGGGGGGAGGGCGGAGGG - Intergenic
972960321 4:44446861-44446883 TTGGGACAGGGGAGGGTGGAAGG - Intronic
973563978 4:52165348-52165370 GTGTGAGGGGGGAGGGTGGGGGG - Intergenic
973584221 4:52375076-52375098 ATGTGACAGGGAAGGGAGGAGGG + Intergenic
976874721 4:89838168-89838190 ATGTGCGTGTGGTGGGTGGGGGG - Intronic
976892858 4:90071611-90071633 ATATGGGAGAGGAGAGTGGATGG - Intergenic
977065225 4:92305283-92305305 ATGTGAGAAGAGAGGGTGGCTGG - Intronic
977442706 4:97089550-97089572 GTGTGCGTGGGGGGTGTGGAAGG - Intergenic
977469704 4:97427707-97427729 TTGTGTGGGGGGAGGGGGGAGGG - Intronic
977804925 4:101286017-101286039 ATGTACAAGGCGGGGGTGGATGG + Intronic
977948698 4:102944223-102944245 ATTTGAGGGTGGAGGGTGGAAGG + Intronic
979986964 4:127327128-127327150 TTGTGTGTGGGGAGGGGGGAGGG + Intergenic
979988902 4:127350706-127350728 ACTTGCGAGGGGAGGGTGGGAGG + Intergenic
980461976 4:133126091-133126113 AGGGGCGGGGGCAGGGTGGAGGG + Intergenic
980654046 4:135759294-135759316 CTCTGCTAGGGCAGGGTGGAGGG - Intergenic
980990478 4:139735020-139735042 ATCTGCGAGGGGAGGGGGCGCGG - Intronic
981007458 4:139890332-139890354 ATGTGCGAAGGGAGAGTGAGAGG + Exonic
981027140 4:140088201-140088223 AAGTGTGATGGGAGGGAGGAAGG + Intronic
981033765 4:140151279-140151301 ACCTGGGAGGGGAGGGAGGAGGG + Intronic
981235082 4:142406124-142406146 AGGTGGGAGGCGAGGGTGGCGGG - Intronic
981669961 4:147275396-147275418 ATGTCGGTGGGGAGGGTGGGTGG - Intergenic
982160857 4:152568079-152568101 ATGAGCCAGAGGAGCGTGGAAGG - Intergenic
983174745 4:164575219-164575241 ACTAGAGAGGGGAGGGTGGAAGG + Intergenic
984070343 4:175103405-175103427 AAGGGAGAGGGGAGGGAGGAGGG + Intergenic
984070364 4:175103458-175103480 AAGGGAGAGGGGAGGGAGGAGGG + Intergenic
984498440 4:180528959-180528981 TTGTGTGTGGGTAGGGTGGAGGG - Intergenic
984612723 4:181858657-181858679 ATATGCCAGGGGATGGAGGAGGG + Intergenic
984943755 4:184955324-184955346 ATGTGTGTGTGGAGGGAGGAGGG + Intergenic
985054621 4:186025590-186025612 GAGTGTGAGAGGAGGGTGGATGG + Intergenic
985397351 4:189558016-189558038 ATTTGGGTGGGGATGGTGGAAGG - Intergenic
985542208 5:492354-492376 ATGGGGGAGGGGAGGGAGGTAGG + Intronic
985805060 5:2037703-2037725 ATGGGAGAGGGGAGAGAGGAGGG - Intergenic
985831569 5:2237577-2237599 ACCTGAGAGGGGAGGGTGGGAGG + Intergenic
986015200 5:3751542-3751564 GGGTGAGAAGGGAGGGTGGAGGG + Intergenic
986681001 5:10232748-10232770 ATGGCCCAGGGGAGGCTGGAGGG + Intronic
986795106 5:11202637-11202659 ATGGGAGAGGGGAGGCTGCAGGG - Intronic
986806301 5:11311764-11311786 GTGTGTGAGGTGAGGGTGCATGG - Intronic
986816219 5:11414746-11414768 ATTTGAGAGTGGAGGGTGGGAGG - Intronic
987331418 5:16860745-16860767 ATGAACGATGGGTGGGTGGAGGG + Intronic
987958104 5:24766130-24766152 CTGGGCTAGGGGAGGGGGGAGGG + Intergenic
987971072 5:24945305-24945327 ATTTGGCAGGGGAGGGTGGCGGG - Intergenic
988675361 5:33427854-33427876 CTATGGGAGGGGAGGATGGATGG + Intergenic
989082286 5:37635814-37635836 ATGTGTCATGGGAGGGTGGGAGG + Intronic
990236427 5:53772830-53772852 ATGTGGGATGGGCGGGAGGAGGG + Intergenic
990976311 5:61564696-61564718 ATGTGAGAGGGGATGATGCAAGG + Intergenic
992489055 5:77223375-77223397 ATGGGTGGGGGGAGGGGGGAGGG - Intronic
993204587 5:84863344-84863366 AGGGGGGAGGGGAGGGAGGAAGG - Intergenic
993374628 5:87135646-87135668 AGGGGAGAGGGGAGGGAGGAGGG + Intergenic
993552481 5:89291088-89291110 ATGTGCGGGAGGAGGGGGGTGGG - Intergenic
994387972 5:99154668-99154690 ATTGGAGAGTGGAGGGTGGAAGG + Intergenic
994535970 5:101029796-101029818 ACTTGAGAGGGGAGGGTGGGAGG + Intergenic
995327548 5:110908086-110908108 ATGGGGTAGGGGAGGGGGGAGGG + Intergenic
996499767 5:124203794-124203816 ATCTGCTAGGGCAGTGTGGAAGG + Intergenic
996777328 5:127146654-127146676 ATGGGTGGGGGGAGGGGGGAGGG + Intergenic
997703568 5:135925256-135925278 GGGTGGGATGGGAGGGTGGAGGG - Intronic
997747862 5:136315406-136315428 AGGTGGGAAGGGATGGTGGAGGG + Intronic
999669352 5:153945081-153945103 CTCTGCTAGGGGAGTGTGGAAGG - Intergenic
1000698186 5:164415600-164415622 ACTTGAGAGGGGAGGGTGGGAGG - Intergenic
1000823058 5:166009317-166009339 ATCAGAGAGTGGAGGGTGGAGGG - Intergenic
1001313797 5:170629056-170629078 ATGTGCGAGGTGGGAGTGGAGGG - Intronic
1002163497 5:177331202-177331224 ATGTGCAAGGGGCTGGAGGATGG - Intergenic
1002435095 5:179226518-179226540 CTGTGGGAGGCCAGGGTGGATGG - Intronic
1002466625 5:179411931-179411953 CGGTGGGGGGGGAGGGTGGAAGG - Intergenic
1002466717 5:179412141-179412163 CGGTGGGGGGGGAGGGTGGAAGG - Intergenic
1002466948 5:179412670-179412692 TGGTGGGGGGGGAGGGTGGAAGG - Intergenic
1002466977 5:179412739-179412761 CGGTGGGGGGGGAGGGTGGAAGG - Intergenic
1002467057 5:179412921-179412943 AGGTCGGGGGGGAGGGTGGAAGG - Intergenic
1003186393 6:3835143-3835165 TTGTGTTAGGGCAGGGTGGAAGG + Intergenic
1004030026 6:11859411-11859433 GTGAGAGAGGGGAGAGTGGAGGG + Intergenic
1004764069 6:18704643-18704665 ATGGTGGAGGGGAGGATGGAGGG - Intergenic
1005804566 6:29462244-29462266 AAGGGCAAGTGGAGGGTGGATGG - Exonic
1006004096 6:30988780-30988802 GTGTGGGGGGGGAGGGGGGAGGG + Exonic
1006133477 6:31882407-31882429 AAGGGCGAGGAGGGGGTGGAGGG + Intronic
1006228066 6:32557701-32557723 TTGTGGGAGGGGAGGCAGGAGGG - Intronic
1006230657 6:32583850-32583872 TTGTGGGAGGGGAGGCAGGAGGG - Intronic
1006384195 6:33720122-33720144 ATGGGTGAGGGGAGGGCGGGTGG - Intergenic
1006806446 6:36792538-36792560 ATGTGTCACGGGAGGGAGGAAGG + Intronic
1006984039 6:38166157-38166179 CTGTGCGTGGGGGAGGTGGAGGG - Intergenic
1006984047 6:38166185-38166207 CTGTGCGTGGGGGAGGTGGAGGG - Intergenic
1006984135 6:38166462-38166484 CTGTGCGTGGGGGAGGTGGAGGG - Intergenic
1007024847 6:38560727-38560749 ACTTGAGCGGGGAGGGTGGAAGG - Intronic
1007133166 6:39495831-39495853 ATGGGGGAGGGGATGGAGGAGGG + Intronic
1007373955 6:41443757-41443779 GTGTGCGAGGGGATGGGGGAAGG + Intergenic
1007391097 6:41549727-41549749 ATGGTGGGGGGGAGGGTGGAGGG + Intronic
1008242256 6:49127714-49127736 CTGTGCAAGGGCAGTGTGGAAGG + Intergenic
1008288397 6:49682761-49682783 ATGAGGGAAGGGAGGGAGGAAGG - Intergenic
1011203986 6:84871943-84871965 GTGTGTGTGCGGAGGGTGGAGGG + Intergenic
1011232655 6:85180134-85180156 AGGGGCGAGGTTAGGGTGGAAGG - Intergenic
1011236918 6:85228274-85228296 CTCTGCTAGGGGAGTGTGGAAGG - Intergenic
1011241806 6:85279681-85279703 ATGTGTGGGGGGTGGGTGGGTGG - Intergenic
1011371428 6:86640986-86641008 ATGTGTGCTGGGAAGGTGGAGGG + Intergenic
1011493375 6:87915348-87915370 ATGTGTGTGTGGAGGGTGGGAGG + Intergenic
1012637186 6:101558566-101558588 ATGTGGTAGGGGTGGGTGTATGG + Intronic
1012723971 6:102784504-102784526 ATTTGGGAGGGGAGAGTGGTGGG + Intergenic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1013837115 6:114345707-114345729 ATTTGGGAGGAGAAGGTGGAAGG + Intergenic
1014290378 6:119551329-119551351 GTGAGCAAGGGGAGGATGGAAGG - Intergenic
1015163966 6:130182625-130182647 AGGAGGGAGGGGAGGGAGGAAGG + Intronic
1015764288 6:136699545-136699567 GTGGGCGAGGGGAGAGTGGCAGG - Intronic
1015982950 6:138857441-138857463 GTGTGGGAGGTGAGGATGGAGGG - Intronic
1016294439 6:142559846-142559868 TTGTGTGGGGGGAGGGGGGAGGG - Intergenic
1016317697 6:142808471-142808493 ATGTGGGAGGGATGGATGGATGG + Intronic
1017163913 6:151390767-151390789 TTGGGGGAGGGGAGGGAGGAGGG - Intronic
1017286264 6:152680157-152680179 GTGTGTGAGGGGAGGGGAGATGG - Intergenic
1017301619 6:152867593-152867615 GTATGTGAGGTGAGGGTGGATGG - Intergenic
1017491138 6:154946208-154946230 GTGGGGAAGGGGAGGGTGGAAGG - Intronic
1017542084 6:155413340-155413362 ATGGGCGAGGGGAGGGCTGGGGG + Intronic
1017754551 6:157518388-157518410 AGGGGTGGGGGGAGGGTGGAAGG + Intronic
1018137645 6:160793011-160793033 ATGTGTGTGGGGAGGACGGATGG - Intergenic
1018326707 6:162677980-162678002 ATGGGTGAGTGGAGGGTGGGAGG - Intronic
1018418008 6:163618046-163618068 ATCAGAGAGTGGAGGGTGGAGGG - Intergenic
1018837902 6:167498812-167498834 AGGTCAGTGGGGAGGGTGGATGG - Intergenic
1019299608 7:296501-296523 CTGTGCTCGGGGAGGATGGAGGG - Intergenic
1019353876 7:568955-568977 CTCTGGGAGGGGAGGGTTGAGGG + Intronic
1019704557 7:2491339-2491361 ATGGGGGATGGGTGGGTGGATGG - Intergenic
1019891901 7:3954231-3954253 AGGCAGGAGGGGAGGGTGGAGGG - Intronic
1019891965 7:3954411-3954433 AGGCAGGAGGGGAGGGTGGAGGG - Intronic
1019891991 7:3954475-3954497 AGGGGAGGGGGGAGGGTGGAGGG - Intronic
1019914730 7:4125373-4125395 ATGGGTGATGGGTGGGTGGATGG + Intronic
1020278062 7:6636840-6636862 TTGTGGGTGGGGAGGGAGGAGGG - Intergenic
1020583168 7:10031382-10031404 ATGAGGGATGGGAGGGTGCATGG + Intergenic
1021293965 7:18880646-18880668 ACTTGAGAGAGGAGGGTGGAAGG + Intronic
1022015583 7:26346067-26346089 ATGTGCGGGGGGATGCTGGCTGG - Intronic
1022543342 7:31160311-31160333 ATGTGGGAGGGGTGGGAGGTGGG - Intergenic
1024616338 7:51117074-51117096 TTGTGCAGGGGGAGGGGGGAGGG - Intronic
1025115088 7:56250838-56250860 AGTTGAGAGGTGAGGGTGGAGGG + Intergenic
1026148891 7:67771662-67771684 AGGGGAGAGGGCAGGGTGGACGG - Intergenic
1026308739 7:69166085-69166107 GTGGGGGAGGGGAGGGGGGAGGG + Intergenic
1026471087 7:70694515-70694537 ATGTGCGGAGGGAGGGAGGAGGG - Intronic
1027566940 7:79807039-79807061 AGGTGGGGGGGGAGGGGGGAGGG - Intergenic
1027988658 7:85329858-85329880 GTGGGTGGGGGGAGGGTGGAGGG - Intergenic
1029126026 7:98295750-98295772 GTGTGCTTGGGGTGGGTGGAGGG - Intronic
1029459354 7:100686348-100686370 ATTTGCGAGGGGATCGAGGAGGG - Exonic
1029880799 7:103807608-103807630 GCTTGAGAGGGGAGGGTGGAAGG - Intronic
1033440448 7:141373643-141373665 ATGTGTGTTGGGGGGGTGGAGGG - Intronic
1033597054 7:142865870-142865892 AGGAGCCAGGGGAGGGTGGGTGG - Intronic
1034140038 7:148806803-148806825 ATGTACCTGGGGAGGGTGCAGGG + Intergenic
1034165422 7:149021704-149021726 ATGTCCCAGGGGAAGTTGGAGGG + Intronic
1035286899 7:157812386-157812408 ATGAGGGAGGTGAGGGAGGAGGG + Intronic
1035971900 8:4258377-4258399 AGGAGGGAGGGGAGGATGGAAGG + Intronic
1036397882 8:8384305-8384327 CTGTGCAAAGGGAGTGTGGAAGG + Intronic
1036630549 8:10511227-10511249 ATGTGGGAAGGGACTGTGGAAGG - Intergenic
1037807990 8:22069111-22069133 ATGTGTGAGGGGAGGGAGTTAGG - Intronic
1037886652 8:22599391-22599413 AGGGGCGAGGGGAAGGGGGAGGG - Intronic
1037901800 8:22693071-22693093 AAGTTCGGGGGGAGGGGGGAGGG + Exonic
1038067074 8:23974369-23974391 GTGGGGGAGGGGAGGGAGGAGGG + Intergenic
1038761042 8:30384482-30384504 AGGGGAGAGGGGAGGGAGGAAGG + Intronic
1039352950 8:36782297-36782319 ATGAGGGAAGGGAGGGAGGAAGG - Intergenic
1039367374 8:36944456-36944478 GTTTGAGTGGGGAGGGTGGAAGG + Intergenic
1042192266 8:66198916-66198938 ATGTGTGAGGTGGGGGTGGGTGG - Intergenic
1042253717 8:66781938-66781960 ATGTGTGAGGGGAGGGGAGAAGG + Intronic
1042325741 8:67526025-67526047 ATGAGCGAGGCGAGGGGGAAGGG - Intronic
1042655598 8:71092024-71092046 ATGTGGCAGGGGAGGGTACAGGG - Intergenic
1042864507 8:73345517-73345539 ATGTGTTAGGGGTGGGAGGAGGG - Intergenic
1043516170 8:80996792-80996814 TTGAGTGAGGGGAAGGTGGAGGG + Intronic
1043692605 8:83174381-83174403 CTGAGCGATGGGATGGTGGAGGG - Intergenic
1045036175 8:98178221-98178243 ATGGGCAGGGGAAGGGTGGAAGG - Intergenic
1045127123 8:99104556-99104578 AAGGGAGAGGGGAGGGGGGACGG - Intronic
1045319333 8:101069920-101069942 GTGTGCGAGGGGGTGGGGGAAGG + Intergenic
1045723293 8:105139674-105139696 ATGTGTGTGGGGAGGGTGGTGGG + Intronic
1048096732 8:131303835-131303857 ACTTGAGAGGGGAGGGTGGGAGG - Intergenic
1048294366 8:133203359-133203381 GTGTGTGATGGGCGGGTGGAGGG + Intronic
1048658597 8:136571504-136571526 CTCTGCTAGGGCAGGGTGGAAGG + Intergenic
1049244007 8:141551831-141551853 ATGGGCCAGGGTAGGGCGGAAGG - Intergenic
1049712388 8:144071220-144071242 AAGGGGGAGGGGAGGGGGGAGGG - Intergenic
1049712403 8:144071244-144071266 AGGGGAGAGGGGAGGGGGGAGGG - Intergenic
1050975685 9:11935383-11935405 GAGTGGGAGGGGAGGGTGCAGGG + Intergenic
1051718076 9:20006331-20006353 GTGGGTGAGGGGAGGGGGGATGG + Intergenic
1051986615 9:23096729-23096751 ATCTGCTAGGGCAGTGTGGAAGG + Intergenic
1052315633 9:27113819-27113841 ATAAGTGAGGGGAGGGTAGATGG - Intronic
1052454082 9:28671628-28671650 ATTTGAGAGTGGAGGGTGGGAGG + Intergenic
1053054707 9:34987778-34987800 AAGGGGGAGGGGAGGGAGGAGGG - Intergenic
1053140345 9:35678926-35678948 AGGTGGGAGGGAAGGGAGGAAGG - Intronic
1053337276 9:37286908-37286930 AGGTGGGAGGGGAGGGAGGGAGG - Intronic
1054810932 9:69433302-69433324 GTGTGTGAGGTAAGGGTGGAGGG - Intronic
1054824000 9:69552853-69552875 ATGAGCAAGGTGAGGGTAGAAGG - Intronic
1055535989 9:77245021-77245043 ATGAGTGAGGGGAGAGTGGAGGG + Intronic
1056213023 9:84382605-84382627 ATTTTGGAGGGGAGGGGGGAGGG - Intergenic
1056604936 9:88077828-88077850 ATGGGAGAGGGGAGAGGGGAGGG + Intergenic
1056776541 9:89516983-89517005 ATTTGAGGGTGGAGGGTGGAAGG - Intergenic
1056840796 9:89996662-89996684 GAGTGGGATGGGAGGGTGGAGGG + Intergenic
1057284173 9:93735687-93735709 ATCAGAGAGTGGAGGGTGGAAGG + Intergenic
1057553453 9:96068866-96068888 ATGTGAGTGGGGAGGGGAGAGGG - Intergenic
1058944305 9:109841903-109841925 AGGATAGAGGGGAGGGTGGAAGG + Intronic
1058944313 9:109841923-109841945 AGGGTAGAGGGGAGGGTGGAAGG + Intronic
1059027125 9:110646748-110646770 TGGGGTGAGGGGAGGGTGGAGGG + Intergenic
1059405702 9:114097435-114097457 ACCTGGGAGGGGAGGGAGGAGGG + Exonic
1060124850 9:121033877-121033899 AAGAGGGAGGGGAGGGAGGAAGG - Intronic
1060205793 9:121682138-121682160 ACGGGCTAGGGGAGGGAGGAGGG - Intronic
1060228676 9:121811637-121811659 ATGAGCGAGGGGAGGCTTGTGGG - Intergenic
1060304879 9:122402406-122402428 ATGGGGGAGTGGAGGGTGGTAGG + Intergenic
1060864401 9:126983687-126983709 ATGAGGGAGGAGAGGGAGGATGG - Intronic
1061293492 9:129665494-129665516 AAGTGGGTGGGGAGGGTGAAGGG + Intergenic
1061674337 9:132207354-132207376 AGGAGCGAGCGGAGGGCGGAGGG - Intronic
1061962951 9:133997805-133997827 ATGTGGGAGGGATGGATGGAAGG - Intergenic
1061962962 9:133997840-133997862 ATGTGAGAGGGATGGATGGAGGG - Intergenic
1061963117 9:133998296-133998318 ATGTGGGAGGGATGGATGGAGGG - Intergenic
1062215299 9:135385890-135385912 GTGGGCACGGGGAGGGTGGAGGG - Intergenic
1062542671 9:137048529-137048551 TTGGGAGAGGGGTGGGTGGAGGG + Exonic
1203663322 Un_KI270754v1:3272-3294 ATTTGGGTGGGGATGGTGGAAGG + Intergenic
1185612145 X:1399079-1399101 ATGTGGGAAGGGAGGAAGGAGGG + Intergenic
1185612158 X:1399121-1399143 ACGTGGGAAGGGAGGGAGGAGGG + Intergenic
1186216810 X:7309387-7309409 ATTTGAGAGGGGAGGGTGGGAGG + Intronic
1186228011 X:7422209-7422231 ATGTCAGGGGGTAGGGTGGAGGG - Intergenic
1186514489 X:10156444-10156466 ATTTGAAAGGCGAGGGTGGAGGG + Intergenic
1186700320 X:12083466-12083488 ATCTGCTAGGGCAGTGTGGAAGG + Intergenic
1186818373 X:13260586-13260608 AGGTGGGAAGGGAGGTTGGAGGG - Intergenic
1186850916 X:13579242-13579264 ATTTGAGAGTGGAGGGTGGGAGG - Intronic
1187223396 X:17352783-17352805 TTGTGCGGGTGGAGGGTGGAGGG - Intergenic
1187245424 X:17549413-17549435 ATGGTAGTGGGGAGGGTGGAGGG - Intronic
1187277655 X:17830063-17830085 ATGTGCGAGGGAAGTGGAGAGGG - Intronic
1187407460 X:19016686-19016708 ATGGGTGGGGGGAGGGGGGAGGG - Intronic
1188228014 X:27625854-27625876 ATTTGTGAGTGGAGGGTGGGAGG + Intronic
1188403648 X:29779441-29779463 ATTTGAGAGGGGAGGGAGGGAGG + Intronic
1189230769 X:39450895-39450917 ATGGAGGAGGGGAGAGTGGAGGG - Intergenic
1189241634 X:39529146-39529168 ATGAGGGAGGGGAGTGTGGTTGG - Intergenic
1189351159 X:40276826-40276848 ATGTGTGAGGACATGGTGGAAGG - Intergenic
1190732364 X:53234344-53234366 GGGTGTGAGGGGAGGGTGGGGGG + Exonic
1191579839 X:62748200-62748222 ATGGGTGGGGGGAGGGGGGAGGG + Intergenic
1192029537 X:67494347-67494369 TGGTGTGGGGGGAGGGTGGAGGG + Intergenic
1192220602 X:69195145-69195167 ATGTGGGACTGGAAGGTGGAGGG + Intergenic
1192428726 X:71098578-71098600 ATGTTGGAGGGCAGGGTGGTGGG - Intronic
1192438321 X:71156209-71156231 ATTTGTGGGGGGTGGGTGGAAGG - Intronic
1193460521 X:81786416-81786438 CTCTGCTAGGGCAGGGTGGAAGG - Intergenic
1193584323 X:83301739-83301761 TGGTGTGGGGGGAGGGTGGAGGG + Intergenic
1193739514 X:85201611-85201633 ACTTGAGAAGGGAGGGTGGAAGG - Intergenic
1193801547 X:85942901-85942923 AGGGGTGAGGGGAGGGGGGAGGG - Intronic
1194565129 X:95477234-95477256 ATTGGAGAGTGGAGGGTGGAAGG + Intergenic
1195339373 X:103891259-103891281 GTGTGGTGGGGGAGGGTGGAGGG - Intergenic
1197045067 X:121986447-121986469 ACTTGAGAGGGGAGGGTGGGAGG + Intergenic
1197773813 X:130107354-130107376 CTGTGTGTGGGGAGGGTGGGAGG + Intronic
1198255291 X:134919116-134919138 ATGTCCTAGGGAAGGGTGGATGG - Intergenic
1198756654 X:139989145-139989167 TTGGGTGAGGGGAGGGGGGAGGG - Intergenic
1198796528 X:140402510-140402532 ATTTGAGGGTGGAGGGTGGAAGG + Intergenic
1199435099 X:147804248-147804270 GTGAGTGAGGGGTGGGTGGAAGG + Intergenic
1199681559 X:150228136-150228158 ATGTGGGAGTGGAGGATGGGAGG - Intergenic
1201064913 Y:10088625-10088647 TTTGGCGAGGGTAGGGTGGAGGG + Intergenic
1201184051 Y:11380660-11380682 ATTTGAGGGTGGAGGGTGGAAGG + Intergenic
1201717087 Y:17057103-17057125 ATATGAGAGTGGAGGGTGGGAGG + Intergenic