ID: 952073495

View in Genome Browser
Species Human (GRCh38)
Location 3:29668585-29668607
Sequence ACACTTTTCCAGCTAACTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 136}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952073495_952073504 28 Left 952073495 3:29668585-29668607 CCAGAAGTTAGCTGGAAAAGTGT 0: 1
1: 0
2: 0
3: 15
4: 136
Right 952073504 3:29668636-29668658 CAAAATAATGCACAAAAGGGTGG 0: 1
1: 0
2: 0
3: 28
4: 319
952073495_952073499 1 Left 952073495 3:29668585-29668607 CCAGAAGTTAGCTGGAAAAGTGT 0: 1
1: 0
2: 0
3: 15
4: 136
Right 952073499 3:29668609-29668631 GTTTGCAGGGTCTCGGCCCATGG 0: 1
1: 0
2: 0
3: 12
4: 131
952073495_952073503 25 Left 952073495 3:29668585-29668607 CCAGAAGTTAGCTGGAAAAGTGT 0: 1
1: 0
2: 0
3: 15
4: 136
Right 952073503 3:29668633-29668655 ATACAAAATAATGCACAAAAGGG 0: 1
1: 0
2: 9
3: 91
4: 803
952073495_952073498 -6 Left 952073495 3:29668585-29668607 CCAGAAGTTAGCTGGAAAAGTGT 0: 1
1: 0
2: 0
3: 15
4: 136
Right 952073498 3:29668602-29668624 AAGTGTTGTTTGCAGGGTCTCGG 0: 1
1: 0
2: 1
3: 16
4: 233
952073495_952073502 24 Left 952073495 3:29668585-29668607 CCAGAAGTTAGCTGGAAAAGTGT 0: 1
1: 0
2: 0
3: 15
4: 136
Right 952073502 3:29668632-29668654 AATACAAAATAATGCACAAAAGG 0: 1
1: 0
2: 11
3: 88
4: 884

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952073495 Original CRISPR ACACTTTTCCAGCTAACTTC TGG (reversed) Intronic
903764097 1:25721948-25721970 ACACTTTTCCAGGAAGCTACTGG - Intronic
905631070 1:39518827-39518849 ATACTTTTCCAGCAAACTGCAGG - Intronic
905666691 1:39767349-39767371 ATACTTTTCCAGCAAACTGCAGG + Intronic
906270816 1:44476920-44476942 ACACTTTCCCTGCTTGCTTCTGG - Intronic
910843599 1:91584959-91584981 ACACTTGTCCTGCCAACCTCTGG - Intergenic
910962205 1:92774912-92774934 ACACTTTGCAAGCAAACTTAGGG + Intronic
911654414 1:100426670-100426692 AGTCCTTTCCAGGTAACTTCTGG + Intronic
914220674 1:145679198-145679220 TCACTTTTCCAGCTAGCTGCTGG + Intronic
914473253 1:148002071-148002093 TCACTTTTCCAGCTAGCTGCTGG + Intergenic
916498940 1:165369903-165369925 CCACTCTTCCAGCTGACCTCAGG + Intergenic
918192601 1:182190413-182190435 TCCCTTTGCCTGCTAACTTCGGG + Intergenic
919252628 1:195077722-195077744 ACAGTTTTACAGCTAACTTGTGG - Intergenic
920932250 1:210400109-210400131 GCATTTTTCCAGCTGTCTTCTGG + Intronic
923993193 1:239462529-239462551 ACACTTTTACAGCTGCCTGCAGG + Intronic
924088242 1:240476607-240476629 ACACTGGGCCAGCTAACTTCTGG + Intergenic
1064919683 10:20503020-20503042 ACTCTCTTCTAGCTAACCTCAGG + Intergenic
1066002910 10:31120954-31120976 ACACTTTTTCAGCTACATTGTGG - Intergenic
1068471298 10:57467270-57467292 ACACTATTCCATCTAAATCCTGG - Intergenic
1072977976 10:100075654-100075676 ACACCTTTCCAGATGACCTCAGG - Intronic
1074299691 10:112222644-112222666 ACATTGTTCCTGATAACTTCAGG + Intergenic
1078587862 11:12609815-12609837 ACAGTTTTCCAGCTGTCTTTTGG - Intergenic
1080226246 11:29964156-29964178 ACACTATAGCAGATAACTTCAGG - Intergenic
1082706631 11:56500593-56500615 ACATTTTTCCTGCTATCTTAAGG - Intergenic
1091111552 11:132973702-132973724 ACAATTTTCCAGCTAATCTTTGG + Intronic
1091995937 12:4994124-4994146 ACAGGTTCCCAGCTAACTCCTGG - Intergenic
1095523376 12:43095190-43095212 AGACCTTCCCAGATAACTTCTGG + Intergenic
1097352925 12:58568413-58568435 ACACTTTGCCCTCTACCTTCAGG - Intronic
1097904601 12:64906697-64906719 ACTTTTTTCCAGCTTATTTCTGG + Intergenic
1099766529 12:86994442-86994464 TCTCTTTCCCAGCTAACTTTTGG + Intergenic
1100005214 12:89887243-89887265 ACACTTTTCATTCTGACTTCTGG + Intergenic
1101365679 12:104067785-104067807 ACAAATAACCAGCTAACTTCTGG - Intronic
1104151526 12:126088625-126088647 ACAATTGTCCAGCTTACTACAGG + Intergenic
1104172096 12:126291913-126291935 CCACTTGTGCAGCAAACTTCTGG + Intergenic
1105772781 13:23629192-23629214 ACACCTCTCAAGCTAACTTAAGG + Intronic
1105791895 13:23809262-23809284 ACATTTTGCCAGCTAAATTAAGG - Intronic
1106591705 13:31104042-31104064 GCACTTTTTCAGCTACATTCAGG + Intergenic
1107640719 13:42440626-42440648 TCACTTTTAAAGCTAGCTTCTGG + Intergenic
1110001445 13:70208025-70208047 ACAGTTTTCCAGCCAACTTTTGG - Intergenic
1112808660 13:103191358-103191380 ACACATTTGCAGCTATCTTCAGG + Intergenic
1112836471 13:103520731-103520753 ACACTCATCCTGCTAACTACTGG - Intergenic
1113297386 13:108974419-108974441 ACAGTTTTCCATATAACTTCTGG + Intronic
1115486608 14:33916611-33916633 AAACTTTTCAAACTAACATCAGG - Intergenic
1115876531 14:37867798-37867820 CCACTATTCCAGCTATCTGCAGG - Intronic
1118839699 14:69501123-69501145 ACACTTTTCAAGCTCACTCAGGG - Intronic
1118886017 14:69866441-69866463 ATAATTTTCCAGCTACCTTAGGG - Intronic
1120345171 14:83279429-83279451 AAAGTTTTCCAGCTAAATTATGG + Intergenic
1121826598 14:97015340-97015362 ACTCTTTTCCTGCCTACTTCTGG + Intergenic
1124178841 15:27454088-27454110 AGACTTTTTCCTCTAACTTCTGG - Intronic
1127520946 15:59742502-59742524 TCCCTTGTCCAGCTAACCTCAGG + Intergenic
1129587225 15:76880180-76880202 ACTCTTTTCTTGATAACTTCAGG + Intronic
1130702965 15:86204283-86204305 ACACCATTCCAGCTCACTCCTGG + Intronic
1131798902 15:96049305-96049327 ACACATTTCCAGATAAATTTAGG + Intergenic
1133251979 16:4488454-4488476 ACAGTTTTACAGCAAACTGCTGG + Intronic
1134083116 16:11338092-11338114 ACACATTTCCAGCTCTCTTGAGG - Intronic
1134473109 16:14545718-14545740 ACCCTTTGCCAGCTAAGTTAGGG - Intronic
1136517823 16:30778406-30778428 ACACTCTTTCAGCTCACTTTAGG + Intergenic
1137816052 16:51398345-51398367 AAACTTTTACAGTTAACTCCTGG + Intergenic
1148596738 17:48862410-48862432 AAACTGATCCAGCTGACTTCTGG - Intronic
1151096195 17:71501989-71502011 ACACTTTTCTAGATAAATCCAGG - Intergenic
1153440091 18:5107416-5107438 ACACTGTTCCTGTTAACTTCTGG - Intergenic
1153501101 18:5750999-5751021 ACACTGTTACAGCCAACTGCAGG - Intergenic
1154301080 18:13193167-13193189 ACACTTTTTCTGCTTACTTGGGG + Intergenic
1157023359 18:43813688-43813710 ACACTTTTGCAACCACCTTCTGG - Intergenic
1157107468 18:44788082-44788104 AAATTTTTCCACCTAACATCTGG - Intronic
1163408142 19:17136369-17136391 ACAGTTCTCCAGCTACCCTCTGG + Intronic
1164748563 19:30634229-30634251 AAACTTATCCTGCTAACTTACGG - Intronic
1165708597 19:37993695-37993717 ACACTTTTTCAGGTACGTTCTGG - Intronic
1165988511 19:39791746-39791768 TGACTTTTACAGCTAACTCCTGG - Intergenic
926998607 2:18768411-18768433 ACATTTTTCCCCCTACCTTCTGG + Intergenic
929243595 2:39677700-39677722 AAACCTTTCCAGCAAACCTCAGG + Intronic
931070137 2:58637756-58637778 AGACTCTTGCAGCTAACCTCAGG - Intergenic
932707032 2:74034340-74034362 GCAATATTCCAGCTAACTTGGGG - Intronic
935368357 2:102318551-102318573 ACACTTTTCCCCTGAACTTCAGG - Intronic
942515856 2:176752045-176752067 ACACTTTTAGAGCAAACTTAGGG + Intergenic
943040279 2:182796362-182796384 AAACTTTTCCAGCTCACCACTGG + Intergenic
944130586 2:196343739-196343761 AGAATTCTCCAGCCAACTTCTGG - Exonic
946606541 2:221411440-221411462 ACAATTTGCCAGCTTACCTCAGG - Intergenic
1168810314 20:700536-700558 CCCCTTTTCCAGCTAAGTTCTGG + Intergenic
1170169940 20:13399349-13399371 ACACATATCCAGCTACCTTTTGG + Intronic
1173236429 20:41250047-41250069 ACACTTTTCCCCCCAACTACAGG + Intronic
1173566910 20:44047038-44047060 ACACTCTTCCAAATAACTTTAGG + Intronic
1179213486 21:39347877-39347899 ACAGTTTCCAAGCCAACTTCGGG - Intronic
1185175921 22:49326617-49326639 TCACTTTTCCAGCTCTCTTCAGG - Intergenic
950127800 3:10520978-10521000 AGACTTTTCCAGCTAATAACAGG + Intronic
950842774 3:15983481-15983503 ACACTTTTCCAGATGACCTGAGG - Intergenic
951656305 3:25012683-25012705 TCATTTTTCCAGCTAACTAAAGG - Intergenic
951960494 3:28313663-28313685 ACACTTGTCCAAATATCTTCAGG - Intronic
952073495 3:29668585-29668607 ACACTTTTCCAGCTAACTTCTGG - Intronic
952956463 3:38560808-38560830 ACATTTTTGGAGCTAAATTCTGG + Intronic
957822260 3:85392639-85392661 ACAATTCTCCAGGTAAATTCTGG + Intronic
958228930 3:90870394-90870416 GCACTTTTCCAGCTCAGTTTTGG + Intergenic
958485548 3:94703042-94703064 ACTCTTTTGCATTTAACTTCTGG - Intergenic
958560098 3:95737291-95737313 AGAATTTTGCAGCTAAATTCTGG - Intergenic
960487071 3:118266791-118266813 ACACTTTTGCTCCCAACTTCTGG + Intergenic
961954950 3:130791894-130791916 ACAGTCTTACAGCTGACTTCAGG - Intergenic
964983241 3:162711391-162711413 ACAATTTTAAAGCTAACTTTTGG - Intergenic
966628622 3:182047174-182047196 ACATTCTTCAAGCTAACTTTTGG - Intergenic
966873833 3:184309949-184309971 AAACTCTTCCAAATAACTTCAGG + Intronic
968637880 4:1691594-1691616 TCACCTTTCCAGCTGTCTTCTGG + Intergenic
971488779 4:27189705-27189727 ATTCTTTCCCAGCTAATTTCTGG - Intergenic
974431589 4:61804798-61804820 ACACTTTTTCAGTCAAATTCAGG + Intronic
979706723 4:123728862-123728884 AAATTTTCTCAGCTAACTTCTGG + Intergenic
980645387 4:135636330-135636352 ACACTTTTCCAGGGATCTTGAGG + Intergenic
981089310 4:140716162-140716184 ACAGGTTTCAAGCTATCTTCAGG - Intronic
981730825 4:147895825-147895847 ACACTTTTCCTACTAAGATCAGG - Intronic
983534045 4:168838532-168838554 ACATTTCACCAGCTAAATTCAGG - Intronic
984975862 4:185229483-185229505 ACATTTTACCAGAGAACTTCTGG - Intronic
988739063 5:34051747-34051769 ACATTTTTCCAGTTAAATTGGGG + Intronic
989555736 5:42792532-42792554 ACATTTTTCCAGATTACTTCTGG + Intronic
989747754 5:44851125-44851147 ACACTTTTCATGCTATCTACTGG + Intergenic
990479947 5:56200678-56200700 ACAAATGTCAAGCTAACTTCTGG - Intronic
990739644 5:58899124-58899146 TCACTTTTCCTACAAACTTCTGG + Intergenic
993887678 5:93435574-93435596 ACACTGTTCCTGCAAACTACTGG + Intergenic
994685068 5:102940341-102940363 AGACTTTTGCAGCTACATTCTGG + Intronic
996288232 5:121820801-121820823 ATATTTTTCCAGCTAATTTTTGG - Intergenic
998585308 5:143420838-143420860 ACACTTTTGCAGCTGAATTTAGG - Intronic
1000236474 5:159366360-159366382 ACACTTTTCCATACAACGTCTGG - Intergenic
1004142461 6:13031654-13031676 ACACCTTTCCAGGTAAATTCTGG + Intronic
1015096877 6:129425912-129425934 ATAATTTTAAAGCTAACTTCAGG - Intronic
1015114778 6:129635919-129635941 ACATTTTTCCAGCAAGTTTCTGG - Intronic
1016088897 6:139951101-139951123 ACACTTATACAGTTCACTTCTGG + Intergenic
1017267245 6:152461777-152461799 ACACATTTCCTCTTAACTTCCGG + Intronic
1019664782 7:2246386-2246408 ACACTCTCCCAGCCAACGTCAGG - Intronic
1022459376 7:30590386-30590408 ACACTTTTCCCTCTAATATCAGG + Intergenic
1022555934 7:31296030-31296052 ACAATTTTCTACTTAACTTCAGG - Intergenic
1024577892 7:50779893-50779915 AGACTCTTCCAGCTGCCTTCAGG + Intronic
1024827449 7:53407986-53408008 AGATTTTCCCAGCTAACTTCTGG - Intergenic
1028256121 7:88599685-88599707 AGACTTTTCCTCCTACCTTCAGG - Intergenic
1034041155 7:147878082-147878104 ACATTTTTCCAGCCATCTTTAGG + Intronic
1034776384 7:153830980-153831002 ACACTTTTACAGATCACATCAGG + Intergenic
1035232415 7:157473715-157473737 ATACTTTCCCAGCAAAATTCAGG + Intergenic
1042039067 8:64573167-64573189 ACACTTTTCCTGACTACTTCAGG - Intergenic
1042043041 8:64615174-64615196 ACACTATTCCAACTATGTTCTGG - Exonic
1042668584 8:71234594-71234616 ATACTTTTCCACCTACCTTGTGG + Intronic
1044196776 8:89386341-89386363 ACACTTTTTGAGATATCTTCAGG - Intergenic
1044696694 8:94930250-94930272 ACACTTTTTCAGATTATTTCTGG - Exonic
1048701874 8:137100579-137100601 AAACATTTCCAACTCACTTCAGG + Intergenic
1050090106 9:2009846-2009868 ACTCTTTTCCAGCCAAATTGAGG - Intergenic
1051203685 9:14661249-14661271 ACAGTTATTCAGCAAACTTCTGG - Intronic
1052953451 9:34232528-34232550 TCTCTTTCCCATCTAACTTCTGG - Intronic
1056383937 9:86080041-86080063 ACATTTTTCCTGGTGACTTCAGG - Intronic
1056881571 9:90398576-90398598 ACACTTTTCAAGTTAATTTTAGG - Intergenic
1057579162 9:96270662-96270684 ACAGTGTTCCCGATAACTTCAGG - Intronic
1058136335 9:101311896-101311918 ACACTTTTTTAGCTAACCTTTGG - Intronic
1061673599 9:132202842-132202864 CCACCTTTCCAGCTCACTTGAGG - Intronic
1195091412 X:101463235-101463257 ACAATATTAGAGCTAACTTCAGG - Intronic
1195948662 X:110243145-110243167 TAACATTTCCAGCTATCTTCTGG - Intronic
1197509390 X:127352196-127352218 ACATTTTTCCAGCTTAGTTAAGG - Intergenic
1197640749 X:128965566-128965588 ACACTTTACCAACCAACTTTTGG + Intergenic
1198437921 X:136635391-136635413 ACACTTTTCAAAGTAGCTTCTGG - Intergenic
1198927775 X:141818493-141818515 ACACTTTTTTACTTAACTTCTGG + Intergenic
1201559947 Y:15305240-15305262 ACACTCTTCAAGTTAACTTTTGG - Intergenic