ID: 952076756

View in Genome Browser
Species Human (GRCh38)
Location 3:29706154-29706176
Sequence ATTCTCTTCCTGACATCAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 202}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952076756_952076760 21 Left 952076756 3:29706154-29706176 CCACTTGATGTCAGGAAGAGAAT 0: 1
1: 0
2: 1
3: 16
4: 202
Right 952076760 3:29706198-29706220 CATGAAAATCCCCTTCACAAAGG 0: 1
1: 0
2: 0
3: 13
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952076756 Original CRISPR ATTCTCTTCCTGACATCAAG TGG (reversed) Intronic
900288698 1:1914687-1914709 AGACTCTTCATGCCATCAAGGGG + Intergenic
900667037 1:3822537-3822559 ATTCGCTGCCTGGCATAAAGAGG + Intronic
900825448 1:4922921-4922943 TTCTTCTTCCTGACATCATGCGG - Intergenic
902209913 1:14897292-14897314 ATTCTCTTGGTGACAGCAATTGG - Intronic
902590463 1:17470289-17470311 CTTCTCTTCCTGATATGGAGAGG + Intergenic
905186818 1:36203085-36203107 ATTGAATTCCTGACCTCAAGTGG + Intergenic
906057040 1:42925293-42925315 TTTTTCTCCCTGACATGAAGAGG - Intergenic
909133606 1:71769369-71769391 ACTCTGTTCCTGAAATTAAGGGG - Intronic
910116073 1:83733531-83733553 ATTTTCTTCTTGACATGAACAGG - Intergenic
911198061 1:95015914-95015936 ATTCTCTTCCAGAAATCAAGAGG - Intronic
912204612 1:107495934-107495956 CTTCTCTTCCTGCGATCCAGGGG - Intergenic
916207659 1:162331137-162331159 ACTGTCTTCCTAACATCAAAGGG - Intronic
917687162 1:177428633-177428655 AAGCTCTGCCTAACATCAAGCGG + Intergenic
918390450 1:184054282-184054304 ATTTTCTTCCAATCATCAAGTGG - Intronic
918409444 1:184243592-184243614 ATTCTATTTCTGACAGCCAGAGG - Intergenic
919077733 1:192833102-192833124 ATTCTCTTCCCCACAACAACAGG + Intergenic
920492854 1:206431331-206431353 ATACTCTTCCTGTCTTTAAGTGG + Intronic
924223744 1:241903860-241903882 ATTCCCTCCCTGACATCAGAGGG - Intergenic
1064213215 10:13378198-13378220 ATTCTGTTCCTGTCAGGAAGTGG + Intergenic
1066571604 10:36779361-36779383 CTTCTCTTCCTAAGATCCAGTGG + Intergenic
1067986847 10:51158209-51158231 ATTCTCATAATGACATTAAGAGG + Intronic
1069356473 10:67592292-67592314 ATTCTTGTCCTGAGACCAAGAGG - Intronic
1070810673 10:79296301-79296323 CTTCTCGTCCTGACATCCAGGGG - Intronic
1072674949 10:97458836-97458858 AGTCTCTTCTTGTCATCCAGGGG + Exonic
1072990604 10:100189055-100189077 GTTCTCTTCCTGGCATCATAAGG - Exonic
1075432322 10:122397596-122397618 ATTTTGTTCCTGAAAGCAAGGGG - Intronic
1079038635 11:17042263-17042285 ATACTCTTCCTAATATCCAGCGG - Intergenic
1079038672 11:17042492-17042514 ATACTCTTCCTAATATCCAGAGG - Intergenic
1080575094 11:33591444-33591466 ATTCTCTTGCTGACACAGAGAGG - Intronic
1081254945 11:40880931-40880953 ATTCTTTTCCTTACAACATGTGG - Intronic
1082666152 11:55978601-55978623 ATCCTCTTCCTGAGTTCATGTGG - Intergenic
1083988147 11:66230415-66230437 TTTCTTTTCCTGAAAGCAAGTGG - Intronic
1087765600 11:102149818-102149840 ATTCTGTACCTGACATCACCTGG + Intronic
1088298692 11:108330477-108330499 ACACGATTCCTGACATCAAGGGG - Intronic
1091103708 11:132898954-132898976 ATAGTCTTCCTTACATCCAGTGG - Intronic
1091144758 11:133268346-133268368 ATTCTGTTCCTAACTGCAAGAGG + Intronic
1091722500 12:2823646-2823668 ATTTTTTTCCTGACATCAGTGGG + Intronic
1095414510 12:41961831-41961853 TTTCTTTTTCTGACATGAAGGGG - Intergenic
1095610192 12:44119350-44119372 ATGAGCTTCCTGCCATCAAGAGG - Intronic
1096508695 12:52114825-52114847 ATACTCTTCCTAATATCCAGAGG + Intergenic
1096592789 12:52672902-52672924 ATTTTCCTCTAGACATCAAGAGG - Intergenic
1098194381 12:67984564-67984586 ATGCTCTTCCTGAGACCAATAGG + Intergenic
1098657699 12:73053629-73053651 ATTCTCTGACTTACATTAAGAGG + Intergenic
1098832515 12:75379374-75379396 TTTCTCTTCTTGACAATAAGAGG - Intronic
1101259954 12:103019001-103019023 ATTCTCTTCCTGCCATGAATGGG - Intergenic
1101785408 12:107878585-107878607 ATTGTTTTCTTGACATCTAGTGG + Intergenic
1105810974 13:23995020-23995042 ATGCTGTTCCTGACGTCTAGTGG + Intronic
1107797840 13:44072242-44072264 ATTCTTTTCCTGACATCTTTTGG - Intergenic
1109138276 13:58680963-58680985 TCTCACTTCTTGACATCAAGTGG + Intergenic
1110984664 13:81951796-81951818 ATTTTTTTCCTGAGATCAAACGG + Intergenic
1113313477 13:109154982-109155004 ATTCTGTCCCTGCCATAAAGGGG - Intronic
1114947627 14:27704887-27704909 TTACTCTGCCTGACAGCAAGGGG + Intergenic
1115137265 14:30125808-30125830 GTTCCCTTCCTGACTTCAAGAGG - Intronic
1116517495 14:45818923-45818945 ATACTGTTCCTAACATCTAGTGG - Intergenic
1117481765 14:56152838-56152860 ATTTTCTAACTGACATCAACTGG - Intronic
1117664215 14:58039480-58039502 AGTCTTTTCCTGAAATCAAGTGG - Intronic
1120192176 14:81449612-81449634 GTTATCTTCATTACATCAAGGGG + Intergenic
1120561530 14:85999431-85999453 ATTCTCTTCTTGATATCTAGAGG + Intergenic
1122483360 14:102061975-102061997 TTGCTCTTCCTAACTTCAAGTGG - Intergenic
1122490057 14:102108912-102108934 ATTCTCTTCCTGACTTTAGCAGG + Intronic
1123007817 14:105332872-105332894 CTTCTCTGCCCCACATCAAGAGG - Intronic
1123688271 15:22816015-22816037 ATTTTCTTCCTGATCTTAAGGGG - Intronic
1124424606 15:29553508-29553530 CTTGTCTTCCTCCCATCAAGAGG + Intronic
1125359250 15:38848433-38848455 TTTATCTTCTTGACATCAACTGG - Intergenic
1125801975 15:42457351-42457373 ATTCTTTTCCAGCAATCAAGAGG + Exonic
1127083936 15:55407759-55407781 TTTCTATTCCTGACATCACGGGG + Intronic
1127216813 15:56832154-56832176 ATTCTATACCTTACACCAAGTGG - Intronic
1128482392 15:68050717-68050739 TTTGACTTCCTAACATCAAGAGG + Intergenic
1129093221 15:73174205-73174227 ATTCTCTCCCTCAGCTCAAGAGG - Intronic
1131160191 15:90100685-90100707 ATTCTTTCCTTGTCATCAAGGGG + Intronic
1131860262 15:96645700-96645722 AATCCCTTCCTCTCATCAAGAGG - Intergenic
1134363432 16:13554165-13554187 AGTCTCTTCCTCACCTCCAGGGG + Intergenic
1134470102 16:14517168-14517190 TTTCTGCTCCTGCCATCAAGAGG + Intronic
1134778789 16:16876530-16876552 ATTCTCATTCTGACTTGAAGAGG + Intergenic
1138866879 16:60832584-60832606 CTGCACTTCCTGATATCAAGGGG - Intergenic
1139280894 16:65769537-65769559 ATTCTCTTTTTGACATCAGAGGG + Intergenic
1139280915 16:65769746-65769768 ATTCTCTTTTTGACATCAGAGGG - Intergenic
1140204936 16:72925837-72925859 ATTTTCCTCCTGTCTTCAAGAGG - Intronic
1140602155 16:76490115-76490137 ACTCTCTTCCTGGCATTAATTGG + Intronic
1142106138 16:88303810-88303832 ATTATCTTCCTCTCATCAGGAGG + Intergenic
1143663267 17:8340400-8340422 ATTCTGTTGCTGACATCCACGGG - Exonic
1143834562 17:9680185-9680207 TTTCTCTTTCAGAAATCAAGAGG + Intronic
1150213312 17:63453442-63453464 CTTCTCTTCCAGGGATCAAGGGG + Intergenic
1153996878 18:10450473-10450495 ATTTTCTTCCTGCCTTCAAAGGG + Intergenic
1158494244 18:57939870-57939892 ATTCTCCTCCTGGGTTCAAGTGG + Intergenic
1163322564 19:16583174-16583196 AGGCTATTCCTGACAGCAAGAGG - Intronic
1168261406 19:55197088-55197110 ATCCCCTTCCTGCCTTCAAGTGG - Intronic
925546241 2:5019936-5019958 ATTCTCATCTAGACATCTAGGGG - Intergenic
926474338 2:13303621-13303643 ATTCTCATGCTGCTATCAAGAGG - Intergenic
926868530 2:17386707-17386729 ATTCACTGCCTAACATCAAAGGG + Intergenic
928843217 2:35636627-35636649 AATCTCCTCTTGACACCAAGTGG - Intergenic
929817371 2:45244378-45244400 ATTTTATTCCTAACATCAATAGG - Intergenic
931811135 2:65856256-65856278 ATTCTCTTCCTCACTTCACCTGG - Intergenic
932350282 2:71025647-71025669 ATACTCTTCCTAACATCCACAGG - Intergenic
932934025 2:76080267-76080289 ATTCTTCTCTTGACTTCAAGTGG - Intergenic
933572579 2:84030716-84030738 ATTTTTTTCCTGAAATCAACTGG + Intergenic
936275701 2:111095097-111095119 ATGCTACTCCTCACATCAAGCGG - Intronic
937376237 2:121337630-121337652 TTTCCCCTCGTGACATCAAGAGG - Intergenic
938916907 2:135950961-135950983 AGCCTCTTCCTGACCTCATGTGG - Intronic
940613611 2:156022731-156022753 ATTGTCTTGCTGGCATCTAGCGG - Intergenic
941785589 2:169495097-169495119 ATACAGTTCCTGCCATCAAGGGG + Intronic
942292091 2:174483483-174483505 ATTGTGTTCCTGGCAGCAAGAGG - Intronic
942742368 2:179195189-179195211 ATTCTCTTCCTCAAAACATGGGG - Intronic
943113162 2:183632681-183632703 ATTTTCTTACTGACATCTAGAGG - Intergenic
944096647 2:195975664-195975686 TTTCTCTTCCTCTCCTCAAGTGG - Intronic
947835064 2:233169369-233169391 TTTCACTTCCTGAAGTCAAGTGG - Exonic
948485991 2:238281444-238281466 ATTTTGTTCCTGACTTTAAGGGG - Intronic
1170905177 20:20508829-20508851 AGTGTCTTCTTGACATCAAATGG - Intronic
1174296143 20:49546484-49546506 ATGCTCTTCCTAACCTCCAGAGG + Intronic
1174307591 20:49625305-49625327 ATTCTATTTCTGTCATCAGGCGG + Intergenic
1174394193 20:50236055-50236077 ATTCATTTCCTGACAACAACAGG - Intergenic
1174769741 20:53287918-53287940 AATCTCTTCCTGACATTTATTGG + Intronic
1176976892 21:15332707-15332729 ATTCTCTTCCTGCCCACAAGAGG - Intergenic
1178008632 21:28255619-28255641 ACTCTCTTCCTGATATGAATAGG - Intergenic
1178977922 21:37235783-37235805 ATTATATTCCTGACTTCCAGAGG - Intronic
1180013385 21:45065968-45065990 ATTTTTTTCCTGACCTCAGGGGG - Intergenic
1183116203 22:35694477-35694499 ATTTTGTTCCTAATATCAAGGGG + Intergenic
1183117093 22:35700511-35700533 ATTTTGTTCCTAATATCAAGGGG + Intergenic
1183144332 22:35975693-35975715 TTTCTGTTCCTGACATCAAAAGG - Intronic
1184915028 22:47563413-47563435 ACTCCCTTCCTAACATCACGGGG - Intergenic
949669746 3:6385837-6385859 ATTCACTTCATGGCATCCAGAGG + Intergenic
949861275 3:8507049-8507071 ATCCTCTTCCTGTTATCAAATGG - Intronic
950578199 3:13845781-13845803 ATACTCTTGGTGACATAAAGTGG - Intronic
951661888 3:25075932-25075954 ATTCTCTTTCAGACATCTAATGG - Intergenic
952076756 3:29706154-29706176 ATTCTCTTCCTGACATCAAGTGG - Intronic
952376962 3:32775758-32775780 ATTCTGTTGCTGACAGGAAGCGG + Intergenic
952641085 3:35597039-35597061 TTTCTCTTCTTCCCATCAAGAGG - Intergenic
952970402 3:38647274-38647296 CTTCTCTTCCTCACACCATGGGG + Intronic
954421241 3:50420157-50420179 ATTCACGTCCTGACATCCCGAGG + Intronic
954577238 3:51683351-51683373 TTTCTCCTCCTGGCATCAAGAGG - Intronic
955672421 3:61415844-61415866 ATTCTCATGCTGCAATCAAGAGG + Intergenic
956994725 3:74811859-74811881 ATTCTCTTCCTGATACAAGGAGG - Intergenic
958494128 3:94820628-94820650 CTTCACTTCCTGATATCAACAGG + Intergenic
959982250 3:112529161-112529183 ATACTCTTCCTAATATCCAGAGG + Intergenic
959982278 3:112529307-112529329 ATACTCTTCCTAATATCCAGAGG + Intergenic
963933122 3:151024836-151024858 ATGCTTCTCCTCACATCAAGAGG - Intergenic
966258018 3:177941408-177941430 ATACTTTCCCTGACATAAAGGGG - Intergenic
968250914 3:197212514-197212536 CCTCTCTTCCTGACTTCCAGCGG + Intronic
970499193 4:16659979-16660001 AGTCTCTTGCTGACATCCACTGG - Intronic
971628849 4:28961986-28962008 ATTCTCTTCCTATCAGCAAGTGG + Intergenic
973589847 4:52429926-52429948 ATTCTTTTCCTGGCATTAACTGG - Intergenic
977135982 4:93305144-93305166 ATTTCCTCCCTGATATCAAGAGG - Intronic
978879055 4:113678389-113678411 ATTCTCTTCGTGACATCAGTGGG + Intronic
980012589 4:127613648-127613670 ATACTCTTCCAGACATTGAGAGG - Intergenic
980194411 4:129569821-129569843 CTCCACTTCCTGACATCACGTGG + Intergenic
982808778 4:159800157-159800179 ATTCTCTTCATAACATCAGCAGG - Intergenic
988579603 5:32457661-32457683 CTGCTATTCCTGACATAAAGAGG - Intergenic
989306099 5:39958281-39958303 ATTCTATGTCTGAGATCAAGGGG - Intergenic
992225116 5:74612881-74612903 ATTTTCTTCCTGAGATAAACAGG + Intergenic
992491198 5:77246356-77246378 TTTCTCTTCCTGACCTCAGATGG - Intronic
992575406 5:78105492-78105514 AATCTCTTCCTGACACAATGTGG + Intronic
993232196 5:85249929-85249951 ATTCTCAACCTCACCTCAAGAGG + Intergenic
993605158 5:89980875-89980897 AATCACTTTCTGCCATCAAGTGG + Intergenic
994584117 5:101683755-101683777 ATGATGTTCCTGAAATCAAGAGG + Intergenic
996498162 5:124186013-124186035 ATTCTATTCCTGACAACAGGAGG + Intergenic
997686970 5:135795575-135795597 ATACTGTTCCTAACATCCAGGGG + Intergenic
998859635 5:146429652-146429674 ATTCTCATGTTGAGATCAAGAGG + Intergenic
999862798 5:155666556-155666578 ATTCTCTATGTGACATCAACTGG - Intergenic
1000398712 5:160802846-160802868 TTTCTCTTGCTGAGCTCAAGTGG + Intronic
1006081675 6:31571570-31571592 CATCTCTTCCTGACTTCAGGTGG - Intergenic
1008015310 6:46511893-46511915 ATTCACTTCCTTACATCAGAAGG - Intergenic
1008722535 6:54373829-54373851 TTTCTATTCCTAACATCAAAGGG + Intronic
1009306185 6:62092193-62092215 ATTCACTGTCTGACATGAAGGGG - Intronic
1011530252 6:88312994-88313016 ATTCTGTGCCTGACTTCAAGGGG - Intergenic
1012103599 6:95124009-95124031 ATTTACTTCCTAACATAAAGGGG + Intergenic
1012174211 6:96059346-96059368 ATTCTCTGACTGACCTCACGTGG - Intronic
1012775473 6:103489729-103489751 ATACTCTTCCTAATATCCAGGGG + Intergenic
1013528865 6:111000965-111000987 ACTCTTTTCCTGACTTTAAGAGG + Intronic
1014889212 6:126821881-126821903 AATCTCTTCATGACAGGAAGTGG - Intergenic
1018764322 6:166920689-166920711 ATTGGCTTCCTGGCCTCAAGAGG + Intronic
1019867604 7:3727473-3727495 ATTCTCTCCCTGGCAAAAAGAGG - Intronic
1021622604 7:22563417-22563439 GTACTCTACCTGACAGCAAGTGG - Intronic
1022033593 7:26514243-26514265 ATTGTCACCCTGAAATCAAGGGG - Intergenic
1022753425 7:33257378-33257400 TGTCTCTTCCTGCCAACAAGTGG + Exonic
1024638564 7:51310687-51310709 AGTCTCTTTCTGTCATCAGGTGG + Intronic
1026043177 7:66886008-66886030 ATTGTCTTCCTGACTTCTATAGG + Intergenic
1029678665 7:102092060-102092082 ATTCTTTTCCTGTCAAGAAGTGG - Intronic
1030320048 7:108156815-108156837 ATTCACTTCCTGAGATCACCAGG - Intronic
1031124960 7:117763203-117763225 ATTTTCTGACTTACATCAAGTGG + Intronic
1032949349 7:136889326-136889348 GTTCTCTTCCTTAGCTCAAGAGG - Intronic
1033285733 7:140039219-140039241 AATCCCTTTCTGACAACAAGAGG + Intronic
1033838840 7:145349077-145349099 ATTTTCTTCCTGAAAATAAGTGG + Intergenic
1034168193 7:149042147-149042169 TTTCTCTTCCTGGCATCACAGGG - Intergenic
1035550050 8:515634-515656 ATCCTCTTCCTGACATCAGTGGG - Intronic
1036240162 8:7074456-7074478 AAACTCTTCCTCACATCCAGAGG - Intergenic
1036820607 8:11936556-11936578 ATACACTTCCTCACATCCAGGGG + Intergenic
1037046651 8:14313553-14313575 ATGATCTGCCTGACCTCAAGTGG + Intronic
1037378549 8:18259879-18259901 ATTCTATTATTTACATCAAGTGG + Intergenic
1037567450 8:20129818-20129840 ATTCTCTCTGTGACTTCAAGAGG - Intergenic
1038722121 8:30046579-30046601 TTTCTCTTCCTCATATCAGGAGG + Intergenic
1039626026 8:39054109-39054131 ATTCTCTTCCTGGCTTGCAGAGG - Intronic
1040090146 8:43390168-43390190 ATTCTCTTCTTGGCAGCAAATGG + Intergenic
1041757197 8:61327671-61327693 TTTCTCTTCCTCATTTCAAGAGG + Intronic
1042883564 8:73522735-73522757 ATTCTCTCCAAGACATCACGAGG + Intronic
1044216045 8:89611861-89611883 TTTCTCTTCCTGGCTTCATGTGG + Intergenic
1044371494 8:91417040-91417062 AATCTCTTTCTGACTTAAAGAGG - Intergenic
1044486301 8:92758377-92758399 TGTCTCTTGGTGACATCAAGAGG - Intergenic
1044903900 8:96978923-96978945 ATTATTTGCCTGACATGAAGTGG - Intronic
1045764703 8:105653345-105653367 ATTCTCTACCTGGCATATAGTGG - Intronic
1045925652 8:107576997-107577019 ATATTCTTCCTAATATCAAGAGG + Intergenic
1046408473 8:113807099-113807121 TTTCTTTTCCTTACATCAATGGG + Intergenic
1046457977 8:114493491-114493513 AGACTCTTCATGATATCAAGGGG - Intergenic
1046482423 8:114839671-114839693 ATTCTGTTCCTTGCTTCAAGAGG - Intergenic
1046824698 8:118674818-118674840 ATTCATTTCCTTCCATCAAGGGG + Intergenic
1047394863 8:124487238-124487260 ATTCACTTCCTGAAATAAAAGGG + Exonic
1050282847 9:4069906-4069928 CTTATCTTCCTGACATCCACAGG - Intronic
1051949540 9:22615078-22615100 ATTCTTCTCATGCCATCAAGTGG + Intergenic
1054796841 9:69310263-69310285 ATTCTCTTTCTGCAATCAATAGG + Intergenic
1059908238 9:119012728-119012750 ATTATCTTTATTACATCAAGAGG + Intergenic
1187775625 X:22753384-22753406 GTACTCTTCCTGAAATGAAGAGG + Intergenic
1189255490 X:39635331-39635353 ATTCTCCACCTCCCATCAAGAGG - Intergenic
1189366994 X:40396448-40396470 CTTCTCTGCCTGACATCCATGGG - Intergenic
1189589527 X:42496605-42496627 AAGCTCTTCCTGCCATCATGAGG + Intergenic
1190266561 X:48830712-48830734 TTTCTCTTCCCCACATCAGGAGG + Intergenic
1190501874 X:51087245-51087267 ATTCTCTACCTGATATCCACTGG - Intergenic
1192154162 X:68731340-68731362 ATTCTCTTCCTGAAAACTACAGG + Intergenic
1193660637 X:84253284-84253306 ATTCTCTCCTTTACATCCAGTGG + Intergenic
1195345266 X:103944098-103944120 ATCCTCTACCTGACATCACTGGG + Intronic
1195402302 X:104474076-104474098 ATTTTCTTCCTGAATTCAATTGG + Intergenic
1198249410 X:134865744-134865766 ATTCTCTTCCTGTCAGTAAGTGG - Intergenic