ID: 952080952

View in Genome Browser
Species Human (GRCh38)
Location 3:29756730-29756752
Sequence TACCCACAACTCCCCAATTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 169}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952080944_952080952 29 Left 952080944 3:29756678-29756700 CCATATCACCAAGCTACCCACAT 0: 1
1: 0
2: 2
3: 12
4: 115
Right 952080952 3:29756730-29756752 TACCCACAACTCCCCAATTCAGG 0: 1
1: 0
2: 0
3: 6
4: 169
952080950_952080952 1 Left 952080950 3:29756706-29756728 CCCAGCAACTACAAAATGTGGGA 0: 1
1: 0
2: 0
3: 12
4: 153
Right 952080952 3:29756730-29756752 TACCCACAACTCCCCAATTCAGG 0: 1
1: 0
2: 0
3: 6
4: 169
952080945_952080952 21 Left 952080945 3:29756686-29756708 CCAAGCTACCCACATTTCTTCCC 0: 1
1: 0
2: 4
3: 44
4: 386
Right 952080952 3:29756730-29756752 TACCCACAACTCCCCAATTCAGG 0: 1
1: 0
2: 0
3: 6
4: 169
952080951_952080952 0 Left 952080951 3:29756707-29756729 CCAGCAACTACAAAATGTGGGAG 0: 1
1: 0
2: 1
3: 15
4: 146
Right 952080952 3:29756730-29756752 TACCCACAACTCCCCAATTCAGG 0: 1
1: 0
2: 0
3: 6
4: 169
952080946_952080952 13 Left 952080946 3:29756694-29756716 CCCACATTTCTTCCCAGCAACTA 0: 1
1: 0
2: 3
3: 27
4: 231
Right 952080952 3:29756730-29756752 TACCCACAACTCCCCAATTCAGG 0: 1
1: 0
2: 0
3: 6
4: 169
952080947_952080952 12 Left 952080947 3:29756695-29756717 CCACATTTCTTCCCAGCAACTAC 0: 1
1: 0
2: 1
3: 22
4: 300
Right 952080952 3:29756730-29756752 TACCCACAACTCCCCAATTCAGG 0: 1
1: 0
2: 0
3: 6
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952080952 Original CRISPR TACCCACAACTCCCCAATTC AGG Intronic
904255534 1:29252173-29252195 CACCCACATCTCACCATTTCAGG + Intronic
907345368 1:53773810-53773832 CACCCACAACTCCCCCAGACTGG + Intronic
908681013 1:66660942-66660964 TCCCTACAACTCCCCATTCCCGG - Intronic
915163505 1:153935309-153935331 TATCCATATCTCCCGAATTCAGG - Intronic
915651242 1:157312434-157312456 TACACACAACTGCCTAATGCTGG + Intergenic
916424105 1:164664387-164664409 TTCCCACAGCTTCCCAATTGTGG - Intronic
916744074 1:167670815-167670837 CACCCATCAGTCCCCAATTCTGG + Intronic
920731193 1:208487579-208487601 GACCGAGAACTCACCAATTCCGG - Intergenic
922232329 1:223697948-223697970 AACCCAAGACTCCCCAAATCTGG + Intergenic
1062786390 10:268834-268856 ATCCCACAGCTCCCCAAGTCTGG - Intergenic
1064826354 10:19407068-19407090 TACTCCCCACGCCCCAATTCTGG + Intronic
1066244151 10:33566202-33566224 TTCCCAGAACTCCCACATTCTGG + Intergenic
1067901849 10:50249896-50249918 TAGCCACAAATCCCCTATTTTGG - Intergenic
1068455683 10:57250893-57250915 GACCAAGAACTCACCAATTCCGG + Intergenic
1069282257 10:66669622-66669644 TACCCACAGCTCCTCTTTTCTGG + Intronic
1070951903 10:80437726-80437748 TCCCCACACCTCCCTAATCCAGG - Intergenic
1071003950 10:80860669-80860691 GACCAACAACCCACCAATTCCGG + Intergenic
1071113556 10:82190977-82190999 TTCCTACAACTCCCCACCTCAGG + Intronic
1072129819 10:92483560-92483582 TACCCCCATCTCCCTAATACAGG - Intronic
1073461282 10:103667309-103667331 TCCCCACGACTCCCCAACCCTGG + Intronic
1073707171 10:105998185-105998207 TACCCACAACCCCAGAATCCAGG - Intergenic
1077636473 11:3844970-3844992 TACCAAGAACTCACCTATTCAGG - Intergenic
1080682980 11:34493302-34493324 TTCCCTAAAATCCCCAATTCTGG + Intronic
1082942203 11:58718239-58718261 TACTCACAATTTCCAAATTCTGG + Intronic
1084211223 11:67623788-67623810 TCCCTGCAACACCCCAATTCTGG + Intergenic
1085462459 11:76702323-76702345 TGCCCCCAACTCCCCACTCCTGG + Intergenic
1092237165 12:6817422-6817444 TACCCATAACCCCCCAACTCAGG - Intronic
1093064176 12:14639359-14639381 TTTCCACCACTCCCCAACTCAGG - Intronic
1093321904 12:17723315-17723337 TTCTTAAAACTCCCCAATTCTGG - Intergenic
1093759377 12:22890338-22890360 TAACCACTCTTCCCCAATTCTGG + Intergenic
1095115123 12:38343934-38343956 TACCAACATCCCCCGAATTCTGG - Intergenic
1109745997 13:66623171-66623193 GACCAACAACCCACCAATTCCGG + Intronic
1110614833 13:77529972-77529994 TTCCCACCACTGCCTAATTCAGG - Intergenic
1114259223 14:21025306-21025328 TCCCCACACCGCCCCAATGCGGG - Intronic
1116653975 14:47628005-47628027 GACCAACAACCCACCAATTCCGG + Intronic
1118403980 14:65405324-65405346 TAATCACAAATCCCCATTTCTGG - Intergenic
1118558738 14:67055704-67055726 GACCAAGAACTCACCAATTCTGG - Intronic
1118780828 14:69006480-69006502 CACCCCCACCTCCCCAGTTCGGG + Intergenic
1124114654 15:26830160-26830182 GACCAAGAACTCACCAATTCCGG - Intronic
1129552301 15:76466114-76466136 GACCCAAAACTTCCCAAATCTGG - Intronic
1130043915 15:80429597-80429619 TTCCCACAACTCCCCTTCTCAGG - Intronic
1130547164 15:84865173-84865195 TACCCAGAACTCCCCAACAAAGG + Intronic
1132097874 15:99001223-99001245 GACCAACAACCCACCAATTCTGG + Exonic
1132836644 16:1957342-1957364 GACCAAGAACTCACCAATTCCGG - Intronic
1134105432 16:11482284-11482306 TACCCCCAGCTCCTCAGTTCAGG - Intronic
1137241426 16:46657901-46657923 TCCCCACCACACCCCAATTAAGG + Exonic
1137626514 16:49912250-49912272 CACCCTCAACTCCCCATATCTGG + Intergenic
1139605724 16:68016801-68016823 AACCCACACCTCCCAGATTCAGG - Intronic
1142365427 16:89647441-89647463 GACCCACAAAACCCCAACTCTGG + Intronic
1143217863 17:5238686-5238708 TGCCCACTTCTCCCCATTTCTGG + Intergenic
1143552912 17:7642250-7642272 GACCAAAAACTCACCAATTCCGG + Intergenic
1144054584 17:11528081-11528103 TACCCCCAACCCCCCAAATTTGG - Intronic
1147517214 17:41131401-41131423 TCCCCACAATTCCCCAATCAAGG - Intergenic
1148747668 17:49927579-49927601 GACCCACACCTCCCCACTGCAGG + Intergenic
1155757921 18:29524892-29524914 TATCCACAAGATCCCAATTCTGG - Intergenic
1159260304 18:66004912-66004934 GACCAAGAACCCCCCAATTCCGG - Intergenic
1159443692 18:68513372-68513394 TAACCCCCACCCCCCAATTCTGG + Intergenic
1162107179 19:8376998-8377020 GACCAAGAACCCCCCAATTCCGG + Intronic
1162237234 19:9318958-9318980 TCCCTGCAACACCCCAATTCTGG - Intergenic
1162299112 19:9834416-9834438 TACCCACAGTTCCCCAACTCTGG + Intergenic
1163650153 19:18512782-18512804 GAGCCTCAACTTCCCAATTCAGG - Intronic
1163902038 19:20111299-20111321 TACCCAAACCTCCCAAATTCAGG + Intronic
1166420196 19:42630695-42630717 GACCCCCAAATCCCCACTTCTGG + Intronic
926097668 2:10092830-10092852 GACCAAGAACTCGCCAATTCTGG + Intergenic
926474629 2:13307573-13307595 CACCAAGAACTCACCAATTCCGG - Intergenic
930038734 2:47104340-47104362 TCCCTGCAACACCCCAATTCTGG + Intronic
930582838 2:53232884-53232906 TGACCACAACTCCCCAAAACAGG + Intergenic
934061379 2:88297410-88297432 TACCCCAAACTCCCTAATTGCGG + Intergenic
934596046 2:95610515-95610537 GACCGAGAACTCACCAATTCTGG - Intergenic
937306945 2:120877526-120877548 TAGCCACCACTCCCCCATTTTGG + Intronic
937608031 2:123825906-123825928 GACCCAGAACCCACCAATTCTGG - Intergenic
937716403 2:125038060-125038082 GACCAACAACCCACCAATTCTGG + Intergenic
944857743 2:203784649-203784671 GACCAAGAACTCACCAATTCCGG - Intergenic
946294945 2:218776681-218776703 TTCCCACCACTTCCCTATTCTGG + Intergenic
1169077343 20:2769312-2769334 TGCACACAAATCCCCATTTCAGG - Intergenic
1169137827 20:3208455-3208477 AACCCCCACCTCCCGAATTCAGG + Intergenic
1175340592 20:58226933-58226955 GACCCTCAATTGCCCAATTCTGG - Intronic
1175516167 20:59571667-59571689 TGCCCAACTCTCCCCAATTCTGG - Intergenic
1176722766 21:10405375-10405397 TAGCCCCAAATCCCCAATCCAGG + Intergenic
1176888473 21:14284902-14284924 TTCTCACAACTCCCCAAAGCTGG - Intergenic
1179879505 21:44287495-44287517 TGCCCCCAGCTCCCCCATTCAGG + Exonic
1183323909 22:37181069-37181091 TACCCACTGCTCCCCAAGGCTGG - Exonic
949556185 3:5155444-5155466 GACCCAAAACTCCCCAAATTTGG - Intronic
951619728 3:24587965-24587987 TCCCCTCAGCTCCCCATTTCTGG + Intergenic
952080952 3:29756730-29756752 TACCCACAACTCCCCAATTCAGG + Intronic
954670240 3:52287210-52287232 TCCCCACAACTCACCCCTTCTGG - Intronic
956438966 3:69261348-69261370 GACCAAGAACTCACCAATTCTGG + Intronic
960913885 3:122678467-122678489 TACCTACAACTCACTGATTCAGG + Intergenic
961177997 3:124851903-124851925 TACCAACAACTCCCCAAAAAGGG + Intronic
963499259 3:146104776-146104798 TTCCCTCAACTCCCCAATAAGGG + Intronic
963855577 3:150249927-150249949 TACCCACAGCACCACAATGCTGG - Intergenic
965245060 3:166257708-166257730 GACCCAGAACCCACCAATTCCGG - Intergenic
967095835 3:186176538-186176560 CTCCCACACCTCCCCCATTCTGG - Intronic
968131065 3:196193101-196193123 TACACAAAACTCCCCAACACTGG - Intergenic
968362209 3:198155029-198155051 TACCCAGGAATGCCCAATTCAGG - Intergenic
969055427 4:4398713-4398735 TACCCACAACAGCCCAAATGTGG - Intronic
969936604 4:10688195-10688217 TACCCACAACTCAATATTTCTGG - Intergenic
971281009 4:25242630-25242652 TCCCTGCAACACCCCAATTCTGG - Intronic
972927709 4:44032093-44032115 TGACCTCAACTCCCCAATGCCGG - Intergenic
973144096 4:46803921-46803943 GACCAACAACCCACCAATTCCGG - Intronic
974328303 4:60444095-60444117 CCCACACAGCTCCCCAATTCAGG - Intergenic
974807377 4:66898196-66898218 GACCAAGAACTCACCAATTCTGG - Intergenic
974838666 4:67278550-67278572 TCCCTGCAACACCCCAATTCTGG - Intergenic
975548215 4:75582633-75582655 GACCAACAACTCCCCAAATCTGG + Intronic
976231030 4:82843109-82843131 AACCCACAACTCCCTAATCTGGG - Intronic
976500820 4:85787052-85787074 CACCCACAAATCCCAAATTTTGG + Intronic
976846259 4:89491338-89491360 GACCAAGAACCCCCCAATTCCGG + Intergenic
977058192 4:92219779-92219801 AACCTACAACTCCCCATTTAAGG + Intergenic
978201104 4:106024347-106024369 GCCCCACCACTCCCCAGTTCAGG + Intergenic
983290518 4:165798539-165798561 GACCAAGAACTCACCAATTCCGG - Intergenic
985703506 5:1387465-1387487 TTCCCCCAGCTCCCCAAGTCAGG + Intergenic
987216253 5:15740460-15740482 TATCCACTGCTCCCCCATTCAGG + Intronic
987793846 5:22603734-22603756 TACCTATAACTCCCCCAATCTGG - Intronic
989298158 5:39854481-39854503 AAGCCAATACTCCCCAATTCTGG + Intergenic
995116513 5:108486626-108486648 TACCCACATCTCCCAATTTAAGG + Intergenic
996422543 5:123278268-123278290 TACCCTGACCTCCCCAAGTCAGG - Intergenic
997363575 5:133311177-133311199 TATCCACAACTCCCCACACCTGG - Intronic
999427425 5:151500037-151500059 GACCCCCACCTCCCCAAATCTGG + Intergenic
1000302251 5:159966636-159966658 TCCCTACAACTCCCCACCTCTGG - Intronic
1000903386 5:166935364-166935386 GACCAAGAACTCACCAATTCCGG - Intergenic
1004942440 6:20574035-20574057 TAGCCACAACTACTTAATTCAGG - Intronic
1006166857 6:32070359-32070381 CACCCACAGCTCCCCAAGGCGGG + Intronic
1006348627 6:33503999-33504021 TACCAAAAACCCACCAATTCTGG + Intergenic
1009406937 6:63325603-63325625 GACCCAGAACCCACCAATTCCGG - Intergenic
1009407535 6:63329475-63329497 TCCCTGCAACACCCCAATTCTGG - Intergenic
1010609205 6:77932294-77932316 AAGACAAAACTCCCCAATTCTGG - Intergenic
1010939420 6:81898013-81898035 TCCCAACAACTTCCCATTTCTGG - Intergenic
1011974924 6:93283785-93283807 GACCAAGAACCCCCCAATTCCGG + Intronic
1012145195 6:95671308-95671330 TACCAAGAACCCACCAATTCCGG + Intergenic
1012312559 6:97745337-97745359 TACCCATAACTCTCCATTTTAGG + Intergenic
1016000038 6:139032689-139032711 TACACACAACTCCCCCTTTTTGG + Intronic
1019231602 6:170569984-170570006 TACCCATAACTCCCCTTTACTGG + Intronic
1019253471 7:33678-33700 TACCCAGGAATGCCCAATTCAGG + Intergenic
1020122503 7:5513126-5513148 TTCCCAACACTCCCCAAATCTGG - Intronic
1022458314 7:30579005-30579027 TGACCACCACTGCCCAATTCAGG - Intergenic
1024444058 7:49455093-49455115 GACCAACAACCCACCAATTCCGG + Intergenic
1025745532 7:64239391-64239413 TACCCACATTTCCCCACTCCAGG - Intronic
1026441585 7:70449415-70449437 TACCCATAACTGACCAATCCAGG - Intronic
1027463608 7:78486594-78486616 CACCCACAACTCCCAATCTCGGG - Intronic
1028077569 7:86534654-86534676 TCCACACATGTCCCCAATTCTGG - Intergenic
1028243694 7:88450856-88450878 TACCCAAAACTTCTAAATTCTGG + Intergenic
1030599792 7:111580923-111580945 GACCAAGAACTCACCAATTCCGG - Intergenic
1031252972 7:119412402-119412424 GACCAAGAACTCACCAATTCCGG - Intergenic
1032873627 7:136012713-136012735 GACCAAGAACCCCCCAATTCCGG - Intergenic
1036429625 8:8678245-8678267 TGACCACAACTGCCAAATTCAGG + Intergenic
1038638960 8:29308727-29308749 TCCCGGCAACACCCCAATTCTGG + Intergenic
1038695217 8:29800396-29800418 TACCCACATCTAGCCAGTTCAGG - Intergenic
1040649129 8:49430085-49430107 TCCCTGCAACACCCCAATTCTGG + Intergenic
1040952508 8:52951716-52951738 GACCAATAACTCACCAATTCCGG - Intergenic
1043555067 8:81421087-81421109 AACCCACAACTACCCAACTGAGG - Intergenic
1045282076 8:100757949-100757971 TTCCCACCACTCCCCAAGACAGG - Intergenic
1047870546 8:129077360-129077382 CCCCCACAACTACCCTATTCTGG + Intergenic
1048969323 8:139635750-139635772 CACCCACAACCCCCCCACTCAGG + Intronic
1049020585 8:139955200-139955222 TACCCTCACCTCCCCGTTTCTGG + Intronic
1049480065 8:142818365-142818387 TGCCCACTGCTCCCCAATGCTGG + Intergenic
1050222239 9:3405915-3405937 TACCCACAGTTCCCCAAACCTGG + Intronic
1052075635 9:24136288-24136310 GACCAAGAACCCCCCAATTCCGG + Intergenic
1055257274 9:74386256-74386278 TACCCACAGCTCCCCACTCTTGG + Intergenic
1055461936 9:76527837-76527859 GACCAACAACCCACCAATTCTGG - Intergenic
1057752912 9:97806489-97806511 TACCAACAACTCCACAATGTAGG + Intergenic
1057890931 9:98869314-98869336 TAACAACCACTCCCAAATTCAGG + Intergenic
1058020147 9:100077876-100077898 TAACCACAACAGCCCAATCCAGG + Intronic
1059066601 9:111092072-111092094 CACCCCCAACTTCCCACTTCTGG + Intergenic
1059223723 9:112651846-112651868 TAGCTACAACTCACAAATTCTGG - Intronic
1059768046 9:117402481-117402503 TACCCACATCTTCCCATCTCAGG - Intronic
1061755406 9:132808924-132808946 TCCCCACCACTCCCCAAGCCAGG - Intronic
1062746899 9:138218691-138218713 TACCCAGGAATGCCCAATTCAGG - Intergenic
1185545504 X:940782-940804 TGCCAGCGACTCCCCAATTCTGG + Intergenic
1186323093 X:8451766-8451788 GACCCAGAACCCGCCAATTCCGG - Intergenic
1188881679 X:35498645-35498667 GGCCCACACCACCCCAATTCTGG - Intergenic
1192015965 X:67331282-67331304 TTCCCCCAACTCCCAAATCCTGG - Intergenic
1193490774 X:82145157-82145179 TCCCCATAACACCCCCATTCTGG + Intergenic
1199074416 X:143512461-143512483 TCCCCAGAACACCCCTATTCTGG + Intronic
1199093421 X:143715729-143715751 TCCCCACAACACCCCTATTCTGG + Intronic
1199214911 X:145252441-145252463 TCCCCACAACACCCCTATTCTGG - Intronic
1201712801 Y:17011230-17011252 GACCAAGAACTCACCAATTCTGG - Intergenic