ID: 952083997

View in Genome Browser
Species Human (GRCh38)
Location 3:29795711-29795733
Sequence CTGGGAGGAAGGAGGGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3687
Summary {0: 1, 1: 1, 2: 31, 3: 389, 4: 3265}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952083988_952083997 28 Left 952083988 3:29795660-29795682 CCTTGAGTAGATTTCTTAAAATA 0: 1
1: 0
2: 4
3: 45
4: 503
Right 952083997 3:29795711-29795733 CTGGGAGGAAGGAGGGAAGAGGG 0: 1
1: 1
2: 31
3: 389
4: 3265

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952083997 Original CRISPR CTGGGAGGAAGGAGGGAAGA GGG Intronic
Too many off-targets to display for this crispr