ID: 952086701

View in Genome Browser
Species Human (GRCh38)
Location 3:29831113-29831135
Sequence TCCACCCTGAGTAAAGTTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 111}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952086701_952086703 16 Left 952086701 3:29831113-29831135 CCTGAAACTTTACTCAGGGTGGA 0: 1
1: 0
2: 0
3: 8
4: 111
Right 952086703 3:29831152-29831174 TATACATAGGAATGAAAGTATGG 0: 1
1: 0
2: 0
3: 34
4: 415
952086701_952086702 3 Left 952086701 3:29831113-29831135 CCTGAAACTTTACTCAGGGTGGA 0: 1
1: 0
2: 0
3: 8
4: 111
Right 952086702 3:29831139-29831161 TAAACAACTTTCATATACATAGG 0: 1
1: 1
2: 2
3: 28
4: 305

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952086701 Original CRISPR TCCACCCTGAGTAAAGTTTC AGG (reversed) Intronic
900296435 1:1953936-1953958 TCCTCCCTGAGGAATGTTGCAGG - Intronic
901154284 1:7125094-7125116 TGCTCCCTGAGTAGAGTTCCAGG + Intronic
901871145 1:12140074-12140096 TCCACACTGAGTACAGTGCCTGG + Intronic
904102941 1:28048656-28048678 TCTACCTTGAGTAAAAATTCTGG - Intronic
910178008 1:84451970-84451992 TCCACAGTGAGTCAAGATTCTGG - Intergenic
910491299 1:87774597-87774619 TCCAACCTCAGTTAATTTTCTGG - Intergenic
910841345 1:91565079-91565101 TGGACCCTGAGTAATGGTTCCGG - Intergenic
923199543 1:231698034-231698056 TCATGCCTGAATAAAGTTTCTGG - Intronic
924657947 1:245990466-245990488 TCGACCTTGAATAAAATTTCTGG + Intronic
1064095286 10:12419819-12419841 TCCACCCAGAGTCATGTTTCTGG - Intronic
1068796892 10:61093294-61093316 GCCAACCTGAGTAAAGTTAGAGG - Intergenic
1068823860 10:61410893-61410915 TCCACCCTGAATTAAATTACTGG - Intronic
1069852600 10:71419822-71419844 TCCTGCCTGAATAAAGTTTCAGG - Intronic
1071456851 10:85857583-85857605 TCCACCCTCAGTCAGGTTTGTGG + Intronic
1071878917 10:89873588-89873610 TACACCCTGAGAAAGGATTCAGG - Intergenic
1077890760 11:6416663-6416685 TCCTCTCTGAGAAAAATTTCTGG + Intronic
1081314273 11:41612525-41612547 TCCTTCCTGATTAAAGTTGCAGG - Intergenic
1086008188 11:82065492-82065514 AACAACCTCAGTAAAGTTTCAGG - Intergenic
1086883582 11:92177586-92177608 TCGACCCTCAGTAAAGGCTCAGG - Intergenic
1090155130 11:124429118-124429140 TCCAACCTGCTTAAAGTTCCAGG - Intergenic
1097210786 12:57367600-57367622 TTCAGCCTGAAGAAAGTTTCTGG - Intronic
1097337448 12:58398808-58398830 AACAACCTCAGTAAAGTTTCAGG - Intergenic
1100792228 12:98143242-98143264 TCCACCTTCAGTCAAGTTCCTGG - Intergenic
1107482573 13:40796851-40796873 ACCACCCTTAGTAAAGTGTTAGG + Intronic
1109995167 13:70113545-70113567 ATCATCCTGATTAAAGTTTCAGG - Intergenic
1112876229 13:104042838-104042860 TCCAGCCTGATTTAAGATTCTGG - Intergenic
1118893922 14:69930361-69930383 TCCAACCTGAGCAATGTTTTTGG - Intronic
1121866964 14:97371535-97371557 TCCAGCTTTGGTAAAGTTTCAGG + Intergenic
1125756103 15:42066027-42066049 TCAAGCCTCAGTAAAGTCTCTGG - Intergenic
1127460191 15:59191667-59191689 TCCACCATCAGGAAATTTTCTGG + Intronic
1127502625 15:59569064-59569086 TTCACTCTGAGAAAGGTTTCAGG + Intergenic
1127919041 15:63478743-63478765 TACACCATGAGTATATTTTCAGG - Intergenic
1128850589 15:70951614-70951636 AACAACCTTAGTAAAGTTTCAGG - Intronic
1133041152 16:3060257-3060279 CCCACCCTGAGTGAGGATTCAGG - Exonic
1139506351 16:67399921-67399943 TCCACACAGACTGAAGTTTCTGG - Intronic
1141147097 16:81538691-81538713 TCCACCCTGAAGAATGTGTCAGG + Intronic
1145882300 17:28361078-28361100 TCCATCCTCATTAAAGTTGCTGG + Intronic
1147019245 17:37518019-37518041 TTCACCCTGAATTAATTTTCAGG + Exonic
1148047179 17:44751270-44751292 TCCATCCTGGGTCAAGTCTCAGG - Exonic
1151201951 17:72475236-72475258 CCCACCCTGAGTAAACTTCAAGG + Intergenic
1151316180 17:73324043-73324065 TTCACCCTGGGGGAAGTTTCTGG - Intergenic
1155181940 18:23355523-23355545 CTCACCCTCAGAAAAGTTTCAGG - Intronic
1156026202 18:32657446-32657468 TCCACCCTGAGTGGAGCTCCAGG - Intergenic
1156409151 18:36811170-36811192 TCCTCCCTGAGAAGAGTTTCAGG - Intronic
1158661006 18:59387476-59387498 TCCACCCTAATTAATGTTTGGGG - Intergenic
1166863023 19:45820620-45820642 TCCCTCCTGAGCAAGGTTTCTGG - Intronic
1168603322 19:57738101-57738123 TGAACCCTGAGAAAAGATTCTGG - Intronic
926809381 2:16742804-16742826 ACCACCCTGCATAAAGTCTCAGG - Intergenic
926841478 2:17085468-17085490 TCCACTCTGGCTAGAGTTTCAGG - Intergenic
927019775 2:19004653-19004675 TCCACCCTGAGTAAGCTCCCGGG + Intergenic
928630219 2:33183919-33183941 TACGCCCTGAAGAAAGTTTCTGG + Intronic
938173841 2:129106239-129106261 CTCTCCCTGAGTAAAGTTTGAGG - Intergenic
940419672 2:153465174-153465196 TCCAACAAGAGTAATGTTTCAGG - Intergenic
943523840 2:188991774-188991796 TACAGCCTCAGTAAAGTTTCAGG + Intronic
1171313435 20:24165389-24165411 TCCACCCTGTGAAAAGTCACAGG - Intergenic
1171338838 20:24411294-24411316 TACACGCTGAGTAAAGGCTCAGG - Intergenic
1182905040 22:33928498-33928520 TACACCCTGAGAAAAGATTCAGG - Intergenic
1184945146 22:47797308-47797330 TCCACCCTGAAAATAGCTTCTGG + Intergenic
952086701 3:29831113-29831135 TCCACCCTGAGTAAAGTTTCAGG - Intronic
955208306 3:56917446-56917468 TCAAGCCTGAGTAAAGTCTGGGG + Intronic
956674094 3:71718705-71718727 TCCTCACTCAGAAAAGTTTCTGG - Intronic
959495408 3:107044994-107045016 TCCATCCTGAGGAAGGCTTCAGG + Intergenic
962155600 3:132945692-132945714 ACCACCCAGAGGAAAGTTCCTGG - Intergenic
963614910 3:147524526-147524548 ACCAACTTCAGTAAAGTTTCAGG - Intergenic
964866267 3:161265406-161265428 TCCATCCTGAGTCCAGTTTGGGG - Intergenic
967377036 3:188816026-188816048 TTTACATTGAGTAAAGTTTCTGG + Intronic
971530996 4:27688808-27688830 AACAACCTCAGTAAAGTTTCAGG - Intergenic
972382560 4:38533121-38533143 TCCTCCCTGAGTCATGTTTTAGG + Intergenic
973208390 4:47586572-47586594 TCCTCCCTGAGTAAGCATTCAGG - Intronic
977116449 4:93034829-93034851 CCCCCACTGAGTAAAGTTTATGG - Intronic
979219277 4:118202670-118202692 AACACCTTTAGTAAAGTTTCAGG - Intronic
982437174 4:155392985-155393007 TCAGCCCTGAGTAAAGTTGATGG - Intergenic
984161138 4:176253673-176253695 AACACCTTCAGTAAAGTTTCAGG + Intronic
985992748 5:3576827-3576849 TCCAATCTCACTAAAGTTTCTGG + Intergenic
987779328 5:22413134-22413156 CCCACACTGAGAAAAGTTTGAGG + Intronic
987893566 5:23915750-23915772 TACAACTTTAGTAAAGTTTCAGG + Intergenic
996014866 5:118521899-118521921 TCCAGCCTGGGTATAGTTTTTGG - Intergenic
996379496 5:122848823-122848845 TCCCCCAGAAGTAAAGTTTCTGG + Intronic
996992137 5:129647989-129648011 TCCAACGTGAGTAGAGTTTGAGG - Intronic
997004598 5:129803476-129803498 TCCACCCAGTTTGAAGTTTCTGG + Intergenic
1000211155 5:159106951-159106973 TCCACCTTAAGGAAAGATTCTGG - Intergenic
1000492258 5:161928503-161928525 ACCAACCTGAGTAAGGTTTTAGG + Intergenic
1001407385 5:171485621-171485643 TCCACCCTGACTAGAGACTCTGG + Intergenic
1004952985 6:20694963-20694985 TCCACCATGAGTGCAGATTCTGG + Intronic
1005300533 6:24465942-24465964 TCCACCCTGACTACACTCTCAGG - Intronic
1007050582 6:38824599-38824621 TCCACCTTAAGTAGATTTTCAGG + Intronic
1007488533 6:42199492-42199514 TCAACCCGGAGGAAACTTTCTGG + Intergenic
1009700405 6:67170369-67170391 TACAACCTCAGTAAAGTTTCAGG + Intergenic
1010773733 6:79861906-79861928 TACACGCTGAGTATTGTTTCTGG - Intergenic
1014907802 6:127050907-127050929 ACCACTCTTTGTAAAGTTTCAGG + Intergenic
1015705976 6:136088159-136088181 TCCATCCTGTGCAATGTTTCAGG - Intronic
1018141677 6:160843928-160843950 TGCACCCAGAGTAAAGTTGATGG - Intergenic
1018237070 6:161736926-161736948 TCAACACTGTGTAAAGTCTCTGG + Intronic
1018372927 6:163185387-163185409 TTCAGCATGAGTAAAGTTCCAGG + Intronic
1018774545 6:167000597-167000619 ACCATCCTGAGTAAATATTCTGG + Intronic
1021216132 7:17917446-17917468 TACAACTTCAGTAAAGTTTCAGG + Intronic
1021783904 7:24133932-24133954 TCCACCCTGGGGTAAGCTTCTGG + Intergenic
1022967869 7:35490419-35490441 TCCCCCATGAATAAAGTTACTGG + Intergenic
1023378207 7:39579310-39579332 TCCACCCTGAGTACACACTCTGG - Intronic
1026177357 7:68009594-68009616 TCCTCCCTGGGTGAAGTTTTTGG + Intergenic
1027460900 7:78452098-78452120 TCCACACTCAGTAAAGTGCCTGG - Intronic
1030963383 7:115955521-115955543 TCCAGCCTCAGTCAAGTCTCAGG + Intronic
1034986066 7:155516219-155516241 TCCACCCAGAGGGCAGTTTCAGG + Intronic
1037052228 8:14389563-14389585 TTCACCCTGATTAGAGTTTCAGG - Intronic
1041375613 8:57207503-57207525 CCCACCCTGAGAAAAGGCTCAGG - Intergenic
1041376376 8:57211882-57211904 CCCACCCTGAGAAAAGGCTCAGG - Intergenic
1041477869 8:58285693-58285715 TGGACCCTGATTAAAGTATCAGG + Intergenic
1042360246 8:67874572-67874594 GACAACTTGAGTAAAGTTTCAGG + Intergenic
1043103386 8:76076498-76076520 TCCATCCTGAAAAAAATTTCTGG - Intergenic
1044961036 8:97530557-97530579 TCCACCCTGTCTAAACTTCCTGG - Intergenic
1046876945 8:119265686-119265708 TGCACCCTGATTTAAATTTCTGG - Intergenic
1048127697 8:131655752-131655774 TCCACCATGAGTAAAAGCTCAGG - Intergenic
1054973512 9:71116283-71116305 TCCAGGCTAAGCAAAGTTTCTGG + Intronic
1055213733 9:73833070-73833092 TCCAATCTCAGTAAAGTTTGGGG - Intergenic
1059441175 9:114307723-114307745 TCCACCATGAGTGAAGTTGCAGG - Exonic
1188733116 X:33676894-33676916 AGAACCCTGATTAAAGTTTCAGG + Intergenic
1193424681 X:81327854-81327876 TCCACCCTGTAGCAAGTTTCTGG - Intergenic
1195575540 X:106445877-106445899 AACAACTTGAGTAAAGTTTCAGG - Intergenic
1197190271 X:123639597-123639619 TGTACCCATAGTAAAGTTTCAGG - Intronic
1201935148 Y:19403475-19403497 TCCCCACTGAGTATAATTTCAGG - Intergenic