ID: 952092090

View in Genome Browser
Species Human (GRCh38)
Location 3:29899611-29899633
Sequence CACACTAGGTCATAAGAAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 122}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952092090 Original CRISPR CACACTAGGTCATAAGAAAG TGG (reversed) Intronic
900588246 1:3444282-3444304 CACACTCAGTAATAAGAAAGTGG - Intergenic
905359897 1:37412012-37412034 CTCACTGGGACATAGGAAAGGGG - Intergenic
905970170 1:42135846-42135868 CACAGTAAGTCTGAAGAAAGAGG - Intergenic
908766863 1:67562071-67562093 CACACTAGGTCACTACAAATGGG + Intergenic
911044361 1:93616675-93616697 CACACCAGATCATCAGAAAGTGG - Intronic
911760544 1:101609215-101609237 CACACTAGCCCATAAGAAAAGGG + Intergenic
919578916 1:199346960-199346982 CAGATTAGGAGATAAGAAAGGGG - Intergenic
921047385 1:211487163-211487185 CATTCTCGGTCTTAAGAAAGGGG - Intronic
922407330 1:225328785-225328807 CTCACTAGGTCGTAAGTAACAGG + Intronic
924673460 1:246151901-246151923 CAGACTTGGTCAAAAGAAAATGG + Intronic
1063291753 10:4756888-4756910 CACAAAAGGTAATAACAAAGTGG - Intergenic
1064856917 10:19778872-19778894 CAAACTTTGTCCTAAGAAAGAGG - Intronic
1065977451 10:30854967-30854989 CACACTTGGTCATAAAAAATAGG - Intronic
1068005522 10:51389199-51389221 GAAAATTGGTCATAAGAAAGAGG - Intronic
1068587384 10:58814472-58814494 AAGACAAGGACATAAGAAAGTGG + Intronic
1075649275 10:124117093-124117115 CACACCGGGTGAGAAGAAAGTGG - Intergenic
1078812887 11:14787732-14787754 CACTCTATCTTATAAGAAAGAGG + Intronic
1083026814 11:59558143-59558165 CACAGTAGGTTCTTAGAAAGCGG - Intergenic
1083836168 11:65269757-65269779 TAAACTACATCATAAGAAAGAGG + Intronic
1086815220 11:91362008-91362030 CACAGTCGGTAATAAAAAAGGGG + Intergenic
1090212115 11:124928437-124928459 CACACTGGGTCCCGAGAAAGGGG - Intronic
1094220178 12:27984580-27984602 TACACTGTGTCATAGGAAAGGGG + Intergenic
1094439145 12:30455673-30455695 CACACTAGGTAATATGGAACTGG + Intergenic
1097339858 12:58425424-58425446 CACACTAGGAAGAAAGAAAGTGG + Intergenic
1098806349 12:75024683-75024705 CAGACTAAGTCTTCAGAAAGTGG - Intergenic
1099355202 12:81626201-81626223 CATACTAGGTTAAAAAAAAGGGG + Intronic
1099481455 12:83171637-83171659 CACACTAGTACATTAAAAAGTGG + Intergenic
1100153046 12:91764634-91764656 AACACCAGGTCAGAAGAAAGAGG + Intergenic
1104314382 12:127683439-127683461 CTTTCTAGGTCAAAAGAAAGAGG - Intergenic
1106120051 13:26852534-26852556 CACACTGGTTCATATGAAACAGG - Intergenic
1107056712 13:36112802-36112824 CATACTTGTTCATAAGTAAGAGG + Intronic
1107122124 13:36807335-36807357 CACATCAGGTCTGAAGAAAGTGG + Intergenic
1108409798 13:50134243-50134265 CACACAACGTCCCAAGAAAGAGG - Intronic
1111348157 13:86991493-86991515 CTCACTATGTCATAAAAAAAGGG + Intergenic
1111469554 13:88660673-88660695 CACACCAGCTCAAAATAAAGGGG - Intergenic
1112557291 13:100480405-100480427 CACACAAGGTCTTAAGACACAGG - Intronic
1114727766 14:24956704-24956726 CACACTAAGTAATGAGACAGGGG + Intronic
1114805189 14:25827268-25827290 CACAATAGCTCCTAAGCAAGTGG - Intergenic
1116909931 14:50450461-50450483 CAAACTAGGACACAAGAAAATGG + Intronic
1117408039 14:55423828-55423850 CACACAAGGTCCTAACACAGGGG - Intronic
1117793979 14:59372339-59372361 CACATTAGGTTATAGAAAAGGGG - Intergenic
1117935887 14:60906496-60906518 CAGTATAGTTCATAAGAAAGTGG + Intronic
1118715260 14:68555356-68555378 CACACTGGCTCTTAAGGAAGTGG + Intronic
1121373907 14:93387963-93387985 GTCACTACGTAATAAGAAAGGGG - Intronic
1124168291 15:27349084-27349106 CAGAATAGGAAATAAGAAAGAGG + Intronic
1126423271 15:48498416-48498438 GACAATAGGTGACAAGAAAGAGG - Intronic
1129533199 15:76286889-76286911 CACAATAGGTCATAAAGAACAGG + Intronic
1135742002 16:24983938-24983960 CACACCAGGTCAAGGGAAAGTGG - Intronic
1137439989 16:48490154-48490176 CACAGTAGGTGATTAGTAAGTGG + Intergenic
1137584346 16:49655300-49655322 AACACTAGCTCATGAGTAAGTGG + Intronic
1141974523 16:87506584-87506606 GACACTGGGGCATAGGAAAGAGG + Intergenic
1143794075 17:9322232-9322254 AACTCTAGGTCATTACAAAGAGG + Intronic
1145405834 17:22591424-22591446 CACACTAGGTCCTACTAAATGGG + Intergenic
1146668613 17:34721527-34721549 CACAGTGAGTCATAAGCAAGTGG + Intergenic
1146963820 17:37007922-37007944 CAAACTAGATCATGAGAAACTGG - Intronic
1159636090 18:70806697-70806719 CACACTTGAGCATAAGGAAGTGG - Intergenic
1161693144 19:5749180-5749202 CAAAGTAGGTAAAAAGAAAGTGG + Exonic
1164104898 19:22101382-22101404 CTCTCTCGGTTATAAGAAAGAGG + Intergenic
1166818364 19:45560801-45560823 CACTCTAGGTCACAACACAGTGG + Intronic
926145709 2:10396198-10396220 CACACTAGGTGCTCAGGAAGAGG - Intronic
927555582 2:24028923-24028945 CACACAAGGTATAAAGAAAGAGG + Intronic
930706885 2:54513203-54513225 CACACTAGAACAGAACAAAGAGG + Intronic
931845543 2:66200065-66200087 CACACTAGGACATATGCATGAGG - Intergenic
936911220 2:117596256-117596278 CACACTAGCTCACCAGAAATGGG - Intergenic
947455065 2:230246432-230246454 CACATTGGGTTATAAGGAAGGGG + Intronic
948368825 2:237474973-237474995 CACACTAAGCCATAAATAAGTGG - Intergenic
1176425255 21:6544745-6544767 TACATTAGGTCATAAGCAGGGGG - Intergenic
1179700746 21:43153062-43153084 TACATTAGGTCATAAGCAGGGGG - Intergenic
1183689291 22:39379228-39379250 CAGACTAGGTCTAAAGAAATTGG - Intronic
1184435685 22:44473739-44473761 CCTACTAGGCCAGAAGAAAGGGG + Intergenic
949091086 3:30007-30029 CACAGTAGGTAGTAAGAATGTGG + Intergenic
949759853 3:7458260-7458282 TACACTAGGGCAAAAGAAATAGG - Intronic
952092090 3:29899611-29899633 CACACTAGGTCATAAGAAAGTGG - Intronic
957031408 3:75246214-75246236 CACAGTAGGTAGTAAGAATGTGG + Intergenic
958950662 3:100412225-100412247 CAGATTAGTTCCTAAGAAAGTGG - Intronic
959185189 3:103037940-103037962 AACATTAGGTCATACCAAAGTGG + Intergenic
960483766 3:118226156-118226178 CACAATAGGTCTGAAAAAAGAGG + Intergenic
961600178 3:128054390-128054412 CACACTAAGAAATTAGAAAGTGG - Intronic
961842904 3:129732576-129732598 CTGACTAGGTAATGAGAAAGGGG - Intronic
962844279 3:139261376-139261398 CACACTAGGTGCTCAGTAAGAGG + Intronic
965366843 3:167811415-167811437 CATATTAGGTCAAAAGACAGAGG + Intronic
965745515 3:171920810-171920832 CACACTAGCTCACCAGCAAGGGG + Intronic
968645261 4:1737533-1737555 CACACTAGGTCAGAGGTAAGAGG + Intronic
971712335 4:30130453-30130475 CACACTTGATTAGAAGAAAGTGG + Intergenic
976556717 4:86459073-86459095 CAAACAAGGCCATAAAAAAGTGG + Intronic
977301445 4:95272110-95272132 TACACAAGGTCATATGAGAGAGG - Intronic
978263314 4:106790232-106790254 GTGACTAGGTCATAAGAAAAGGG + Intergenic
981346750 4:143684618-143684640 CACACTAGTTCATCAGCAATGGG + Intronic
983299775 4:165910162-165910184 CACACTAAGCCTTAAGAAACTGG - Intronic
983877529 4:172893940-172893962 CTGACTAGGTCCTAAGGAAGGGG - Intronic
986434836 5:7718938-7718960 GACACAAGATCAGAAGAAAGAGG + Intronic
988630800 5:32929237-32929259 AACACTAGCTCATAGGAAAGGGG - Intergenic
989194694 5:38705215-38705237 CAAACAAGGTCATCAAAAAGTGG + Intergenic
990720053 5:58684576-58684598 CACACTGGTTCATAGGAAAAAGG + Intronic
991906267 5:71514979-71515001 CACATTAGGTCACAGGAATGAGG + Exonic
991965535 5:72086680-72086702 CACACTAGGTGAGGAGAAACTGG + Intergenic
992158330 5:73976479-73976501 CAGAATAGCTCATAAGACAGAGG - Intergenic
993637844 5:90366920-90366942 CATACTAGGTAAAGAGAAAGAGG - Intergenic
998221452 5:140284982-140285004 CATACTGAGTTATAAGAAAGTGG - Intronic
1007980815 6:46155918-46155940 CACAGTAGGTCAAAAGTAAAAGG - Intergenic
1009648771 6:66445950-66445972 CAAAGTAGGTCATAACATAGTGG + Intergenic
1015177499 6:130326470-130326492 TACAATAGGACAAAAGAAAGGGG - Intronic
1015460053 6:133480137-133480159 CATACTAGCTCATAAGGAATGGG + Intronic
1016759720 6:147723697-147723719 GAAACTTGGTAATAAGAAAGTGG - Intronic
1019200416 6:170309602-170309624 CACACTAGGTTCTATAAAAGTGG + Intronic
1020417459 7:7962266-7962288 CACACCAGGTGACCAGAAAGAGG - Intronic
1021577922 7:22121369-22121391 CTCTCTAGGTAATAAGATAGTGG - Exonic
1022692658 7:32671984-32672006 CACATTGGGTCTTAAGAAACTGG + Intergenic
1022920330 7:35006510-35006532 CACACTGGGTCTTAAGAAACTGG + Intronic
1024130281 7:46345175-46345197 CACACACTGTCATAAGAAAGAGG + Intergenic
1026249961 7:68661200-68661222 CAAACTATGTCATTAGAAAATGG + Intergenic
1027958387 7:84912232-84912254 CATAATAGTTCATAAGAAAAAGG + Intergenic
1031129877 7:117820031-117820053 CATACAAGGTCAAAAGAAAATGG - Intronic
1032632999 7:133673990-133674012 CACAGTAGGTCTTAAGAATAGGG - Intronic
1032907923 7:136393808-136393830 CCCAGAAGGACATAAGAAAGTGG + Intergenic
1034200118 7:149278924-149278946 CCCAGTAGGTCTTCAGAAAGAGG - Intronic
1037496305 8:19444159-19444181 CACACCATGTTATAAGACAGGGG - Intronic
1039373939 8:37014421-37014443 CAGACTTGGGCAGAAGAAAGAGG - Intergenic
1039650169 8:39332884-39332906 CAGCCTAAGTCAAAAGAAAGAGG - Intergenic
1041438169 8:57864393-57864415 GAGATTATGTCATAAGAAAGGGG + Intergenic
1048286265 8:133144195-133144217 TACACTGGGTCATTAAAAAGAGG + Intergenic
1049490881 8:142901208-142901230 CACTTTAGGTCAAAAGAAAGTGG - Intronic
1051056545 9:12994192-12994214 CATACTCTGTGATAAGAAAGAGG + Intergenic
1051542702 9:18237938-18237960 CACACTAGGGCATATGGCAGAGG + Intergenic
1060759533 9:126235665-126235687 CTCACTAGGAAATAATAAAGTGG + Intergenic
1188533441 X:31167892-31167914 CACACTAGCTCATTAAAGAGAGG + Intronic
1188613119 X:32123687-32123709 CTCACTATATCATAAGAAAGCGG - Intronic
1191834459 X:65449135-65449157 CACACTAGGACATATCAGAGAGG + Intronic
1194334972 X:92634426-92634448 CAAAATAGGTCATAAGGCAGTGG - Intergenic
1194460404 X:94159972-94159994 CTTAGTTGGTCATAAGAAAGAGG - Intergenic
1194544828 X:95219863-95219885 AACACTATTTCAAAAGAAAGAGG - Intergenic
1199141811 X:144322330-144322352 CACAATATGTCTTTAGAAAGTGG + Intergenic
1200643451 Y:5751477-5751499 CAAAATAGGTCATAAGGCAGTGG - Intergenic
1200754072 Y:6973319-6973341 CACAGGAGGCCATGAGAAAGAGG + Intronic