ID: 952093754

View in Genome Browser
Species Human (GRCh38)
Location 3:29923305-29923327
Sequence ATGTGCTAGTTTATCTGTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 206}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952093754_952093759 13 Left 952093754 3:29923305-29923327 CCATCACAGATAAACTAGCACAT 0: 1
1: 0
2: 0
3: 8
4: 206
Right 952093759 3:29923341-29923363 ATAAAACATCTGTCACAATAGGG 0: 1
1: 0
2: 1
3: 23
4: 266
952093754_952093758 12 Left 952093754 3:29923305-29923327 CCATCACAGATAAACTAGCACAT 0: 1
1: 0
2: 0
3: 8
4: 206
Right 952093758 3:29923340-29923362 TATAAAACATCTGTCACAATAGG 0: 1
1: 0
2: 1
3: 16
4: 242

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952093754 Original CRISPR ATGTGCTAGTTTATCTGTGA TGG (reversed) Intronic
901092920 1:6654479-6654501 TTGTGCTGCTTTATCTTTGAAGG - Intronic
901564517 1:10102204-10102226 ATATGCTGTTTTATCTGTGGTGG + Intronic
903702764 1:25262905-25262927 ATTTGTTAGTGTGTCTGTGAGGG - Intronic
903712031 1:25333231-25333253 ATTTGTTAGTGTGTCTGTGAGGG - Intronic
905409187 1:37756535-37756557 CTGAGCTAGATTATCTCTGAAGG - Intronic
909160354 1:72140275-72140297 ATGTGTTAGTTTATTTTTGACGG + Intronic
910246288 1:85142090-85142112 ATGTACTAGTTCATTTGTGGGGG + Intergenic
911371589 1:97001276-97001298 TTGTGTTTGTGTATCTGTGATGG + Intergenic
912574809 1:110659091-110659113 ATGTGCAACTTTATTTGTGAAGG - Intergenic
912742626 1:112215011-112215033 ATTTTCTAGTTTATTTGTGTAGG - Intergenic
913565284 1:120068035-120068057 ATGTACTAGTTTTTTGGTGAAGG + Intronic
913632846 1:120725527-120725549 ATGTACTAGTTTTTTGGTGAAGG - Intergenic
914285872 1:146227390-146227412 ATGTACTAGTTTTTTGGTGAAGG + Intronic
914546904 1:148678143-148678165 ATGTACTAGTTTTTTGGTGAAGG + Intronic
914619604 1:149392219-149392241 ATGTACTAGTTTTTTGGTGAAGG - Intergenic
915739176 1:158105362-158105384 ATGTGCTATTTTATGTTGGATGG + Intergenic
915888502 1:159748996-159749018 CTGTGCTAATTTTTCAGTGATGG - Intergenic
916762460 1:167829554-167829576 ATGTGCTTGTTTGTCAGTCATGG - Intronic
916821838 1:168406595-168406617 ATGTGCTGCATTATCTTTGATGG - Intergenic
917581923 1:176387527-176387549 ATTTTCTAGTTTATTTGTGTAGG + Intergenic
918481983 1:184988449-184988471 ATCTGCTAGGGTGTCTGTGATGG + Intergenic
918820270 1:189245187-189245209 ATTTACTATTTTATCTGTGAAGG - Intergenic
920387163 1:205577238-205577260 TTTTGCTAGTTTATCTGATAGGG - Intronic
921523463 1:216187055-216187077 ATGTGCTAGTTTCTGTTTTAGGG - Intronic
921936946 1:220804304-220804326 ATGTGTTGGTTTAACTGTGCTGG - Intronic
923365075 1:233251784-233251806 AGGTCCTAGTTTTTCTGGGATGG - Intronic
923812340 1:237333092-237333114 AATTACTACTTTATCTGTGATGG - Intronic
924179666 1:241427727-241427749 ATTTTCTAGTTTATTTGTGTAGG + Intergenic
1064426267 10:15232357-15232379 ATGAGCTAGTTTATTTCAGATGG - Intronic
1067430173 10:46237496-46237518 CTGTGCTAGTTTTTGTGGGAGGG + Intergenic
1068281006 10:54869809-54869831 ATGTGCTAGTGGTTCTGTGAAGG - Intronic
1068540570 10:58290091-58290113 TTGTGCTTGGGTATCTGTGAGGG + Intergenic
1069217271 10:65837872-65837894 ATTTGCTTGTTTGTCTGTTAAGG + Intergenic
1069476757 10:68740808-68740830 GTATGCTAGTTTATTTTTGATGG + Intronic
1073934344 10:108612963-108612985 ATGTACAAGTTTTTGTGTGATGG - Intergenic
1075555432 10:123427449-123427471 TTGGGCTATTTTATCTGAGATGG + Intergenic
1076386999 10:130064383-130064405 ATGTGCTGTTTTATCTTTGTAGG - Intergenic
1078482954 11:11695229-11695251 ATTTTCTAGTTTATTTGTGTAGG - Intergenic
1079338763 11:19595005-19595027 AGGTGCAAGTTTATATGGGAGGG + Intronic
1080078640 11:28184025-28184047 ATTTTCTAGTTTATTTGTGTAGG + Intronic
1082196304 11:49310514-49310536 ATTTTCTAGTTTATTTGTGTAGG + Intergenic
1083985796 11:66214421-66214443 AAGAGCAAGTTTCTCTGTGAAGG + Intronic
1087588326 11:100151377-100151399 ATGTTCTAGTGTATGCGTGAAGG + Intronic
1089119903 11:116126436-116126458 ATGGGCCAATTGATCTGTGAAGG + Intergenic
1089984088 11:122796680-122796702 ATGAGGTAGTTTCTCAGTGAAGG - Intronic
1090322571 11:125860694-125860716 ATTTTCTAGTTTATTTGTGTAGG - Intergenic
1090895818 11:130973850-130973872 ATTTTCTAGTTTATTTGAGAGGG + Intergenic
1093257174 12:16883679-16883701 ATGTGCTATTTTATCAGTTTGGG + Intergenic
1095706171 12:45239308-45239330 ATTTTCTAGTTTATTTGTGTGGG + Intronic
1095802877 12:46286864-46286886 ATTTTCTAGTTTATTTGTGTAGG - Intergenic
1098000576 12:65937869-65937891 CTGTGCTGGTTTGTCTTTGAGGG - Intronic
1101684775 12:107008173-107008195 CTGGGCTAGTTTAGCTGAGACGG - Intronic
1103614819 12:122145434-122145456 CTGTGCTACTTTATCTGGGCAGG - Exonic
1109135710 13:58647805-58647827 ATGTGTTTGTTTATGTTTGAAGG - Intergenic
1109822022 13:67669508-67669530 ATGAGCTAGTTTATATCTCAAGG + Intergenic
1111699252 13:91665384-91665406 ATGTGAAAGTTTTTCTGTGCTGG + Intronic
1114421148 14:22584161-22584183 ATGTGCTAGGTTCTCTGCCAAGG - Intronic
1114502849 14:23183993-23184015 ATTGGCTAGTTTATTTCTGATGG - Intergenic
1116265514 14:42684644-42684666 ATTTGGTTGTTTATTTGTGAAGG + Intergenic
1117542998 14:56766884-56766906 ATATTCTAGTTTAACTGTGCTGG - Intergenic
1120073715 14:80132520-80132542 ATGTCTTGGTTTATCTGAGATGG - Intergenic
1120338268 14:83187119-83187141 AGGTGCTACTTAATCTATGATGG + Intergenic
1120515468 14:85464969-85464991 ATGTGCTAGTTTAAGTCTGCAGG + Intergenic
1122458479 14:101876057-101876079 ATGTGGTAGTCTAGTTGTGATGG + Intronic
1124186210 15:27531595-27531617 CTGTGCTGGTTGATCTGAGATGG - Intronic
1125574790 15:40747864-40747886 ATGTGCCTGGTTATCTTTGAAGG - Intronic
1126302389 15:47212402-47212424 AACTGCTATTTTATCTCTGACGG + Intronic
1126729452 15:51667546-51667568 ATGGGCTAATTTATCTATGGTGG - Intergenic
1127217703 15:56842017-56842039 ATGTCATAGTTTTTCAGTGATGG - Intronic
1127817381 15:62623136-62623158 CTGTGCTGGTTAATCTGTGCGGG + Intronic
1131386214 15:92010083-92010105 ATGTGGTAGTTTATCCTAGAGGG - Intronic
1133152342 16:3844366-3844388 ATGTGACAGATTATCTGTGTAGG - Intronic
1133593020 16:7264465-7264487 CTGAGCTAGTTTTTCTGTAAGGG + Intronic
1134514652 16:14876908-14876930 ATGTGCTATTTTAATTGTGGAGG - Intronic
1134702328 16:16275561-16275583 ATGTGCTATTTTAATTGTGGAGG - Intronic
1134969502 16:18519089-18519111 ATGTGCTATTTTAATTGTGGAGG + Intronic
1139107609 16:63846921-63846943 ATGTCTTATTTCATCTGTGAAGG - Intergenic
1140269779 16:73455098-73455120 ATGAGCTACTCCATCTGTGATGG - Intergenic
1141199162 16:81883764-81883786 CTGTGCTAGTTTATCTCCCAGGG - Intronic
1142436589 16:90062871-90062893 ATGTACTAGTTGACATGTGATGG + Intronic
1142700465 17:1656802-1656824 CTGTTCTAGTTGATCTGGGAGGG - Intronic
1144545928 17:16195680-16195702 ATGTGCTAGAATAGCTGGGAAGG - Intronic
1145183750 17:20776102-20776124 CTTTTCTAGTTTATCTGTAATGG - Intergenic
1145194513 17:20878068-20878090 ATGTGCTTTTTTATCTGTCTAGG - Intronic
1145300475 17:21631598-21631620 ATGTGCTAGAATAGCTGGGAAGG + Intergenic
1145349816 17:22071644-22071666 ATGTGCTAGAATAGCTGGGAAGG - Intergenic
1150999903 17:70362946-70362968 ATAGGCTAGTTGGTCTGTGATGG + Intergenic
1157957389 18:52113565-52113587 ATGTAATAGCTCATCTGTGAAGG + Intergenic
1158098944 18:53807546-53807568 ATTTTCTAGTTTATTTGTGTAGG - Intergenic
1158196535 18:54892354-54892376 CTGTGTTAGTGTCTCTGTGAGGG - Exonic
1158621107 18:59033133-59033155 ATGTGATATTTTACCTTTGATGG - Intergenic
1162149625 19:8635725-8635747 ATGTGCAAGTTTTGGTGTGAGGG + Intergenic
925942668 2:8835809-8835831 ATGTGCTACTGTATTTGTCAGGG - Intronic
927285715 2:21354774-21354796 ATTTGCTAGGTTATGTTTGAAGG + Intergenic
932425198 2:71629299-71629321 ATCTGCTTGTTTATTTTTGAAGG + Intronic
933015796 2:77125349-77125371 ATGTGCACCTCTATCTGTGATGG - Intronic
933606281 2:84387825-84387847 ATGATCTAGTCTAGCTGTGATGG + Intergenic
934545612 2:95212585-95212607 ATGTGTTATTTTATCTTTGCTGG + Intronic
937901943 2:127026193-127026215 ATGTATTAAATTATCTGTGACGG + Intergenic
939833115 2:147096258-147096280 ATGTGATAGATGAACTGTGATGG - Intergenic
948328357 2:237144548-237144570 TAGGGCAAGTTTATCTGTGAAGG - Intergenic
1168947415 20:1773118-1773140 ATGTGCTTGCTTATCATTGAAGG + Intergenic
1170459983 20:16568278-16568300 ATGTGCTTGCTTATCTGATAGGG - Intronic
1171112443 20:22496350-22496372 ATGTGAAAGTTAATCTGGGATGG + Intergenic
1171559961 20:26115091-26115113 ATGTGCTAGAATAGCTGGGAAGG - Intergenic
1171563047 20:26145767-26145789 ATGTGCTTTTTTATCTGTCTAGG - Intergenic
1172277658 20:33688738-33688760 CTGTGCTGGTTTAACTGTGGTGG + Intergenic
1173850938 20:46217213-46217235 ATGTGTGAGTATATCTGTGTGGG - Intronic
1175324213 20:58111216-58111238 TTGTGCTAGTTTATCTCTAAAGG - Intergenic
1175500873 20:59449894-59449916 ATGTACATGTTTATCTATGAGGG + Intergenic
1175512946 20:59546745-59546767 ATGTCCTGGATTATCTGTGTTGG - Intergenic
1176316613 21:5251112-5251134 ATTTTCTAGTTTATTTGTGTAGG + Intergenic
1177442566 21:21145951-21145973 ATGTGCCAGCTCTTCTGTGAAGG - Intronic
1179630619 21:42676002-42676024 ATCTGGTTGTTTATGTGTGAAGG + Intronic
1180741589 22:18056926-18056948 CTGTACTAGTTTCCCTGTGATGG - Intergenic
1182067180 22:27438906-27438928 CAGGGCTAGTTTATCTGGGAGGG + Intergenic
1183285570 22:36960625-36960647 ATGAGTTAGTTTATCATTGAAGG + Intergenic
1183704231 22:39467107-39467129 AGACGCTAGTTTATATGTGATGG - Intronic
951361116 3:21725556-21725578 ATTTTCTAGTTTATTTGTGTAGG - Intronic
952093754 3:29923305-29923327 ATGTGCTAGTTTATCTGTGATGG - Intronic
953112527 3:39956902-39956924 ATTTTCTAGTTTATTTGTGTAGG - Intronic
954966123 3:54612562-54612584 TTTTGCTAGTTTCTCTGTGATGG + Intronic
956477115 3:69634126-69634148 ATGTTCTAGTTTATTTGTGTAGG + Intergenic
956610182 3:71114679-71114701 ACAGGCTAGTTCATCTGTGAAGG + Intronic
959314896 3:104791097-104791119 TTATGCTAGATTATCTGTGTAGG - Intergenic
959354968 3:105314581-105314603 ATGTGGTCATTTATCTGTGCCGG + Intergenic
962024030 3:131528348-131528370 ATCTGCTGGCTTATCTATGATGG + Intergenic
962286442 3:134089797-134089819 AAGTGATAGTTTTTCTGTTATGG - Intronic
964460890 3:156926222-156926244 ATGGGCCAGTTTATCTTAGATGG - Intronic
964969887 3:162547116-162547138 ATGAGCTAGTTTATCAATGTGGG + Intergenic
964981581 3:162688488-162688510 ATGTCATAGCTTATCTGTCAAGG + Intergenic
965721282 3:171665314-171665336 ATTTGCCATTTTTTCTGTGAAGG + Intronic
965840207 3:172896093-172896115 ATGAGCCAGTTTATCTGTCTGGG + Intronic
968889797 4:3362401-3362423 ATGTGAGGGTGTATCTGTGAGGG + Intronic
970999652 4:22307835-22307857 ATTTTCTAGTTTATTTGTGTAGG - Intergenic
973701502 4:53541892-53541914 TTGTCCAAGCTTATCTGTGAGGG - Intronic
974700361 4:65435765-65435787 TTTTGCTAGTTTCTCTCTGATGG + Intronic
977056413 4:92198634-92198656 ATGTCCAAGTTTTTGTGTGAAGG + Intergenic
982383453 4:154774495-154774517 TTTTTCTAGTTTATCTGTGTAGG + Intergenic
982904434 4:161049861-161049883 ATGAGCTAGTTTATCAGTCTGGG - Intergenic
984808582 4:183773726-183773748 ATGTGCTCCTTTATCAGTCAGGG - Intergenic
985527136 5:411501-411523 ATGTGCTAATTTTTCTATTAGGG - Intronic
987146787 5:14999107-14999129 ATGTTCTAGTTTGCCTGGGATGG + Intergenic
987222235 5:15802607-15802629 CAGTGCTAGTTTATCAGGGATGG - Intronic
988921954 5:35951288-35951310 GTGTGATAGATTATCTATGAGGG - Exonic
989852078 5:46225907-46225929 TTATTCTAGTTTATCTCTGAAGG - Intergenic
991627885 5:68623228-68623250 ATTTTCTAGTTTATTTGTGTAGG + Intergenic
993191806 5:84692722-84692744 ATGTGCTACTTTATATGAAATGG - Intergenic
994693846 5:103049977-103049999 ATTTTCTAGTTTATTTGTGTAGG - Intergenic
995395674 5:111683990-111684012 ATGGGCTTGTTCATCTCTGAAGG - Intronic
996500431 5:124210237-124210259 ATGTGCTTGTTTACCTTAGAGGG - Intergenic
997121419 5:131176964-131176986 AGGTGCTAGTAGAACTGTGAGGG - Intronic
997575014 5:134968124-134968146 ATGTGCTAGTAGAAGTGTGAGGG + Exonic
1001814313 5:174655243-174655265 ATGTGCTATTTTGTCTGCCAAGG + Intergenic
1003586940 6:7399327-7399349 ATGTGCTTGTGTATATGGGAGGG - Intronic
1006233219 6:32603514-32603536 ATGTGCTCTTTTGTCTGTGTAGG - Intergenic
1006785105 6:36661066-36661088 GAGTGCTAGTGTATCTGTGCCGG - Intergenic
1007947740 6:45841066-45841088 ATGTGCTACATTTTCTTTGATGG + Intergenic
1008207667 6:48683335-48683357 ATTTTCTAGTTTATTTGTGTGGG - Intergenic
1009045159 6:58229364-58229386 ATTTTCTAGTTTATTTGTGTAGG + Intergenic
1009835343 6:68993759-68993781 AGGTGCTCTTTAATCTGTGATGG - Exonic
1011147697 6:84236879-84236901 ATTTTCTAGTTTATTTGTGTAGG - Intergenic
1011353648 6:86451232-86451254 AAGTGCTAAGTTATCTGTGTTGG - Intergenic
1012121811 6:95378204-95378226 ATTTTCTAGTTTATTTGTGTAGG - Intergenic
1012704724 6:102508257-102508279 ATCTATTTGTTTATCTGTGAGGG - Intergenic
1013086055 6:106858802-106858824 ATGAGCTAGTTTATCAATGTGGG - Intergenic
1013435049 6:110095541-110095563 ATGTGCTCCTTTATCTGGAATGG + Intergenic
1015828520 6:137342123-137342145 CTGGGCTAGTTTATCTTTGGAGG + Intergenic
1015998421 6:139018232-139018254 ATGAGATCGTTTCTCTGTGAAGG - Intergenic
1021060169 7:16101417-16101439 ATTTTCTAGTTTATTTGTGTAGG + Intronic
1021684049 7:23164381-23164403 ATGATTTAGTTTATCTTTGAGGG + Intronic
1023041263 7:36175245-36175267 ACATCCTACTTTATCTGTGAGGG - Intronic
1025160288 7:56653448-56653470 AGGTGCTTGGTTATCAGTGAAGG - Intergenic
1025277765 7:57598690-57598712 ATGTGCTAGAATAGCTGGGAAGG + Intergenic
1027590055 7:80107491-80107513 TTCTGCTATTTTATCTCTGAAGG + Intergenic
1028701591 7:93787074-93787096 ATGTCCTGGTTTGCCTGTGACGG + Intronic
1031942115 7:127800007-127800029 ATGTGCTACTGTATGTGTTAAGG + Intronic
1035811569 8:2495861-2495883 ATGAGCCAGTTTATCTGTCTGGG + Intergenic
1035933227 8:3807810-3807832 ATGTGCTAGGATCTCAGTGAGGG - Intronic
1037439044 8:18895293-18895315 ATGAGCTAGTTTTTCAGGGAAGG - Intronic
1038846411 8:31234031-31234053 ATTTTCTAGTTTATTTGTGTAGG + Intergenic
1039729409 8:40257915-40257937 ATGAGCTAGTTTATCTATCTTGG + Intergenic
1041838131 8:62240434-62240456 ATTTTCTAGTTTATTTGTGTAGG + Intergenic
1042712572 8:71734697-71734719 ATGAGCTGGTTTATATGTGGGGG + Intergenic
1043041438 8:75267472-75267494 GAGTCCTAGTTTATCTGTAAAGG + Intergenic
1048011826 8:130463648-130463670 ATGTGCTAGTATGCCTGTTAGGG - Intergenic
1051137023 9:13933976-13933998 ATGTGTCTGTTTATCTGTGAAGG - Intergenic
1052755343 9:32535280-32535302 ATCTTCTATTTCATCTGTGATGG + Intergenic
1055830954 9:80378290-80378312 ATATTCTAGTTTATCCCTGAAGG + Intergenic
1056176254 9:84039198-84039220 ATTTTCTAGTTTATGTGTGCAGG + Intergenic
1056617538 9:88181195-88181217 ATGTGCAACTTTATCAGTGCAGG + Intergenic
1057296056 9:93841967-93841989 ATTTTCTAGTTTATTTGTGTAGG - Intergenic
1059594087 9:115697388-115697410 ATGTGGTAGTTTTTGTATGAAGG - Intergenic
1203370351 Un_KI270442v1:297900-297922 ATGGCCTAGTAGATCTGTGAGGG - Intergenic
1203626020 Un_KI270750v1:23555-23577 ATGTGCTTTTTTATCTGTCTAGG + Intergenic
1185647654 X:1626538-1626560 ATTTTCTTCTTTATCTGTGATGG + Intronic
1187036148 X:15542133-15542155 ATGTGCTACGATGTCTGTGAAGG + Exonic
1188105827 X:26145641-26145663 AGGTGCCAGTTTATATATGAAGG - Intergenic
1189225803 X:39412292-39412314 TTGTACCAGTTTACCTGTGAGGG + Intergenic
1190183689 X:48217002-48217024 ATGTGCTAGCTATTCTGTTATGG + Intronic
1191113703 X:56830131-56830153 ATTTTCTAGTTTATTTGTGTAGG + Intergenic
1191206495 X:57839685-57839707 ATTTTCTAGATTATCTTTGAGGG + Intergenic
1192026991 X:67464398-67464420 ATTTGCTAGTTTTTTTGTTAAGG - Intergenic
1194155101 X:90378449-90378471 ATTTCCTAGTGTGTCTGTGAGGG - Intergenic
1194531312 X:95052669-95052691 ATGTGTGAGTTTATTTCTGAGGG - Intergenic
1194718273 X:97311602-97311624 ATGAGCCAGTTTATCTATCAGGG + Intronic
1196101870 X:111855180-111855202 TACTGTTAGTTTATCTGTGAAGG + Intronic
1197593010 X:128431995-128432017 AAGTGTTATTTTTTCTGTGAAGG - Intergenic
1198921687 X:141735858-141735880 TTATGCTGGTTTGTCTGTGAAGG + Intergenic
1199187159 X:144928600-144928622 ATGTGCAAATGTATCTGTGCTGG - Intergenic
1199681641 X:150228759-150228781 TTGTCCTAGATTATCTGGGAAGG - Intergenic
1199914815 X:152328072-152328094 ATTTTCTAGTTTATTTGTGTAGG - Intronic
1200501453 Y:3955385-3955407 ATTTCCTAGTGTGTCTGTGAGGG - Intergenic
1201298853 Y:12488992-12489014 ATGTGTTTGTTTATGTATGAGGG - Intergenic
1202587905 Y:26451308-26451330 ATGTGCAAGTATATATTTGAAGG + Intergenic