ID: 952094935

View in Genome Browser
Species Human (GRCh38)
Location 3:29939594-29939616
Sequence TGGGAGTTCTTGGGACAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 150}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952094935_952094940 -2 Left 952094935 3:29939594-29939616 CCAGTTTGTCCCAAGAACTCCCA 0: 1
1: 0
2: 2
3: 21
4: 150
Right 952094940 3:29939615-29939637 CAGTTTGTGACTCCTGCCCAAGG 0: 1
1: 0
2: 0
3: 12
4: 159
952094935_952094941 7 Left 952094935 3:29939594-29939616 CCAGTTTGTCCCAAGAACTCCCA 0: 1
1: 0
2: 2
3: 21
4: 150
Right 952094941 3:29939624-29939646 ACTCCTGCCCAAGGTTTTTCTGG 0: 1
1: 0
2: 0
3: 15
4: 148
952094935_952094945 27 Left 952094935 3:29939594-29939616 CCAGTTTGTCCCAAGAACTCCCA 0: 1
1: 0
2: 2
3: 21
4: 150
Right 952094945 3:29939644-29939666 TGGTTCTCCTCAGACCTCTCTGG 0: 1
1: 0
2: 6
3: 45
4: 277

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952094935 Original CRISPR TGGGAGTTCTTGGGACAAAC TGG (reversed) Intronic
904672060 1:32173425-32173447 TTGGAGTTCTTAGGGAAAACTGG - Exonic
911225404 1:95299414-95299436 TGGGAGTTCTTTAGACAGAAAGG - Intergenic
914907614 1:151759743-151759765 TGGAGTTTATTGGGACAAACAGG - Exonic
917062226 1:171053311-171053333 TGGGAGTATTTGGGACCAAGAGG - Intronic
917913718 1:179678438-179678460 TGGTAGTTCTTGGAGCAAATAGG - Intronic
921535697 1:216346286-216346308 TGGGACTCCTTGGGAAAAAAAGG + Intronic
922110896 1:222554207-222554229 TGGGAGTTCTTGGTATAGGCAGG + Intergenic
924483303 1:244455754-244455776 TGGGACTCCTTGGGAAAAACAGG + Intronic
924808620 1:247381721-247381743 TGGGACTTCTTGGGAAAAACAGG - Intergenic
1066699809 10:38115159-38115181 TTGTATTACTTGGGACAAACTGG - Intronic
1067957250 10:50805991-50806013 TAGGAGTTCTAGGGAAAAATAGG + Exonic
1068075880 10:52253012-52253034 TTGGAGGTGTTGGGACATACAGG + Intronic
1070949041 10:80416219-80416241 CTAAAGTTCTTGGGACAAACAGG - Intronic
1071357260 10:84810610-84810632 TGGGACTCCTTGGAAAAAACAGG - Intergenic
1072108779 10:92298353-92298375 TGGGAGTTGTTTGAATAAACAGG - Intronic
1073273121 10:102283806-102283828 TCGGAGTTCTTTGGAAACACAGG - Intronic
1074179822 10:111049537-111049559 TGAGTATTCTTAGGACAAACAGG - Intergenic
1076840915 10:133044770-133044792 TGTGAGTTGTTCTGACAAACGGG - Intergenic
1079950920 11:26803211-26803233 TGAGATTTCTTGGGCCATACTGG - Intergenic
1080810677 11:35701295-35701317 TGGGACTCCTTGGGAAAAACAGG - Intronic
1082687376 11:56257573-56257595 TGAGAGTTATTGGGAAAAGCAGG + Intergenic
1083001541 11:59296851-59296873 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1084878124 11:72149122-72149144 TGGGACTCCTTGGGGAAAACAGG + Intergenic
1085589135 11:77741206-77741228 TGGGAGTTTTTAGTGCAAACGGG - Intronic
1085591645 11:77767717-77767739 TGGGTGTTCCAGGGACAAAAAGG - Intronic
1087307466 11:96502962-96502984 TGGGAGTTGATGGGGCAAGCTGG - Intronic
1088270911 11:108033468-108033490 TGGGAGGCCTTGGGTCATACTGG - Intronic
1089852556 11:121513077-121513099 TAGGATGTCTTGTGACAAACTGG - Exonic
1090279284 11:125442310-125442332 TGGGAGTGCCTGGGACATAGTGG + Intergenic
1092173423 12:6387550-6387572 TGGGAGGCCTGGGGAGAAACTGG - Intronic
1094239899 12:28210568-28210590 TGGGACTCCTTGGGAAAAACAGG - Intronic
1094431335 12:30373116-30373138 GGGGACTCCTTGGGAAAAACAGG - Intergenic
1095330436 12:40955213-40955235 TGGGAAGTCTTGGGTCATACAGG - Intronic
1101415009 12:104501276-104501298 TGGGAGTTCCTGGGAGGGACAGG + Intronic
1103728852 12:123012897-123012919 TGGCTGTTCTTGGGACAAAGTGG - Intronic
1107311525 13:39083363-39083385 TGGGACTTCTTGGGAAAAACAGG + Intergenic
1109368102 13:61384137-61384159 ATTGAGTTATTGGGACAAACTGG + Intergenic
1109888916 13:68581372-68581394 TGTGAGAATTTGGGACAAACTGG - Intergenic
1114069045 14:19094006-19094028 TAGGAGGACTTGGGACAGACAGG - Intergenic
1114093215 14:19305999-19306021 TAGGAGGACTTGGGACAGACAGG + Intergenic
1116692361 14:48125720-48125742 TGTGAATTCTTGGCACAACCAGG + Intergenic
1118822299 14:69353388-69353410 TGGGAGTTCTCTTCACAAACAGG - Exonic
1119305512 14:73604990-73605012 TGGGACTCATTGGGAAAAACAGG - Intergenic
1121003805 14:90473395-90473417 TGGGACTCCTTGGCAAAAACAGG + Intergenic
1122410749 14:101525058-101525080 TGCGTGTTCCTGGGACACACAGG + Intergenic
1122638310 14:103141091-103141113 TGGGAGTTCTGGGGGCGACCAGG - Intergenic
1123128626 14:105968028-105968050 TGGGAGTGATTAGGACACACAGG + Intergenic
1123897283 15:24841446-24841468 TGGGAGGTTTGGGAACAAACTGG - Intronic
1127263445 15:57343013-57343035 TGAGTGTTCTTGGGGCAAACAGG + Intergenic
1127374090 15:58366858-58366880 TGAGAGTTTTTGGGAGAAAGGGG - Intronic
1130776907 15:86993869-86993891 TGAGAGCTCTTGGCAGAAACCGG + Intronic
1131957984 15:97758140-97758162 TAAGAGTTCTAGGGAAAAACCGG - Intergenic
1137056341 16:35748236-35748258 TGGGAGGTCCTGGGACTCACAGG - Intergenic
1138015504 16:53424816-53424838 TGGGACACCTTGGGAAAAACAGG - Intergenic
1138145820 16:54611093-54611115 TGGGAGTTCATGGCACCAAAGGG - Intergenic
1139914596 16:70420251-70420273 TGGCAGTTCGTGGGCTAAACTGG + Intronic
1141401770 16:83754060-83754082 AGGGAGCTTTTGTGACAAACTGG + Intronic
1142310417 16:89309176-89309198 TGGTGGTTCTTGGGGCACACTGG + Intronic
1145405294 17:22585055-22585077 TGGGATTTATTGGGAAAAAAGGG + Intergenic
1147904579 17:43814399-43814421 TGGGAGATCCTGGGACAACTGGG - Intronic
1150028968 17:61711474-61711496 TGGGATTTCTAGGGAAAAAAGGG + Intronic
1152546092 17:81000735-81000757 TGGCAGTCCTGGGGACAGACAGG - Intronic
1152759012 17:82098609-82098631 TGGGAATGCTTGGGCCACACTGG + Intergenic
1154365352 18:13703017-13703039 TGGGACCCCTTGGGAAAAACAGG + Intronic
1155695233 18:28677132-28677154 TGAGAGTTGTTGGAACAGACAGG - Intergenic
1157897947 18:51486322-51486344 TGGGAGTTCATGTGGGAAACGGG + Intergenic
1158761936 18:60400540-60400562 TGGGAGTTGTTGAGATAAAAAGG + Intergenic
1159079266 18:63717716-63717738 TAGGAGTTCTTTGCACATACTGG + Intronic
1160011150 18:75107895-75107917 TGGGAGTTGATGGGACACCCAGG + Intergenic
1164879206 19:31716657-31716679 TGGGCTTCCTTGGGGCAAACTGG + Intergenic
1166224083 19:41384122-41384144 TGGGGGTGCTTGAGACCAACAGG + Intronic
1166402564 19:42494204-42494226 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1166900910 19:46062081-46062103 TGGAACTCCTTGGGAAAAACAGG - Intronic
1168027610 19:53654353-53654375 TGGGACTCCTTGGGAAAAACAGG + Intergenic
926019941 2:9485941-9485963 GGGAAGCTCTTTGGACAAACGGG + Intronic
927685506 2:25168172-25168194 TAGGAGGTCTTGGGACAACCCGG - Intronic
931032416 2:58193715-58193737 TGGAAGTTCTTTTGACCAACTGG - Intronic
932077864 2:68681878-68681900 TGGGAGTGCTGGGGATAACCAGG + Intronic
932714494 2:74091512-74091534 TGTGAGCTCTAGGGACACACAGG - Intronic
935724479 2:106011080-106011102 TGGGATTTATTGGGAAAAAAGGG - Intergenic
935828695 2:106976862-106976884 AGGAAGTTCTTGGGAGACACAGG + Intergenic
939411856 2:141837621-141837643 TGAAAGTTCTTTGGAGAAACTGG + Intronic
939621522 2:144425130-144425152 TGGCAGTTCTAGTGACAAATGGG + Intronic
940454830 2:153883674-153883696 TGGGAGGATTTGGGACAAAAAGG + Intronic
940623594 2:156145102-156145124 TGGGAGTTTTTGGGAACATCTGG - Intergenic
941639588 2:167972750-167972772 TGGGACTCCTTGGGAAAAACAGG + Intronic
946114545 2:217449943-217449965 TGGGAGTTAGTGGGACAGCCAGG - Intronic
948315923 2:237028384-237028406 TGGGAGCTGTTTGGACAAAATGG + Intergenic
948471239 2:238181500-238181522 TTGGACTTCTTGGGAACAACTGG - Intronic
1169284723 20:4298412-4298434 TGAGAGTTCTAAGGACAAAAGGG - Intergenic
1169964877 20:11205660-11205682 TGGAAGTTCTTTGGCTAAACTGG + Intergenic
1170714450 20:18819847-18819869 TGGGATCTCTGGGGGCAAACTGG - Intronic
1172478552 20:35256923-35256945 TGGGGGTTCTTGTTATAAACGGG + Intronic
1175654276 20:60755003-60755025 TGGGAGGACTTGGGAGAAAGAGG - Intergenic
1176242275 20:64080554-64080576 TAGGACATCTTGGGACACACGGG - Intronic
1178721201 21:35011205-35011227 TGAGTATTCTTGGGACAAACAGG + Intronic
1179022472 21:37652680-37652702 TGGGATAACTTTGGACAAACTGG + Intronic
1179606654 21:42520585-42520607 TGAAAGTTCTCGGGATAAACTGG + Intronic
1180487518 22:15816566-15816588 TAGGAGGACTTGGGACAGACAGG - Intergenic
1181515766 22:23411104-23411126 TGAGAGTTCTTGGCACATTCTGG + Intergenic
1185340173 22:50287578-50287600 TGGGAGCTGTTGGGACAGGCAGG - Intronic
949993166 3:9596178-9596200 TGGGATTTATTGGGCCAAATGGG - Intergenic
950685811 3:14618033-14618055 GGAGAGCTCTTGGGAGAAACCGG + Intergenic
951922431 3:27871109-27871131 TGGGATTTCTTGGGACACCAAGG + Intergenic
952094935 3:29939594-29939616 TGGGAGTTCTTGGGACAAACTGG - Intronic
953974966 3:47375524-47375546 TGGGTTTTCTTTGGACAAGCTGG - Intergenic
955564620 3:60230673-60230695 TGAGAATTCTTTGGACAAAAAGG - Intronic
956201779 3:66713891-66713913 TGTGAGATCTTGGGACTATCAGG + Intergenic
957570152 3:81936854-81936876 TGGGAGCTCTTAGGTCATACTGG - Intergenic
959440269 3:106365760-106365782 TGGTAGTTCTGGAGACAAACTGG + Intergenic
961595805 3:128015332-128015354 TGGGACTCCTTGGGAAAAACAGG + Intergenic
961665419 3:128491032-128491054 TGTGAGTTCTCGGGCCAAAAGGG - Intronic
967732479 3:192918521-192918543 TTGGAGTTCTTGGGATAGAGAGG - Intergenic
968661074 4:1799045-1799067 CCGGAGTCCTTGGGACAGACTGG + Intronic
971814107 4:31464941-31464963 TGGGACTCCTTGGAAAAAACAGG - Intergenic
971998297 4:33995284-33995306 TGGGATTTATTGGGAAAAAAGGG - Intergenic
974185245 4:58437085-58437107 TAAGAGTGCTTGGCACAAACTGG + Intergenic
981137525 4:141228535-141228557 GGGAAGTTCTTAGGACAAACAGG - Intronic
990116112 5:52393687-52393709 TGGGAATTCTGGGGAGAACCTGG + Intergenic
990290593 5:54346761-54346783 CTGGACTTCTTGGGAAAAACAGG + Intergenic
992653638 5:78886540-78886562 TGGGAGATCTTGGCAAAGACAGG + Intronic
999361717 5:150991554-150991576 TGGGAGTTGATGGGGCAAGCTGG + Intergenic
1001374254 5:171239804-171239826 TGGTAGTTCTAGACACAAACAGG + Intronic
1002157503 5:177294603-177294625 TGGGAGTCTCTGGGACAAAGAGG - Exonic
1003591895 6:7443719-7443741 TTGAGGATCTTGGGACAAACAGG + Intergenic
1004963804 6:20823975-20823997 TGGATGTTCTTGGGGCAAATGGG + Intronic
1008547660 6:52597740-52597762 TGGGGGTTTCTGGGACAAATTGG + Intergenic
1009716783 6:67408063-67408085 TGGAACTCCTTGGGAAAAACAGG + Intergenic
1010719146 6:79262714-79262736 TGGGACTCCTTGGGCAAAACAGG - Intergenic
1014783410 6:125590361-125590383 TGAGTATTCTTGGGACATACAGG - Intergenic
1015377524 6:132527684-132527706 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1015710283 6:136131526-136131548 TGGGAGTTACTTGGGCAAACAGG - Intronic
1017619477 6:156281059-156281081 GGGGTGGTCTGGGGACAAACTGG - Intergenic
1020350549 7:7214286-7214308 TGGAACTCCTTGGGAAAAACAGG - Intronic
1022063651 7:26827658-26827680 TGTGATGTCTTGGGAAAAACTGG - Intronic
1022609842 7:31859283-31859305 TGGGATTTATTGAAACAAACAGG - Intronic
1027996310 7:85429226-85429248 TGAGTATTCTTGGGGCAAACAGG - Intergenic
1028095615 7:86756507-86756529 TTGAAGTTCTGGGGAAAAACTGG - Intronic
1028318531 7:89434182-89434204 TGGGAGTTAATGGGGCAAGCTGG - Intergenic
1029811058 7:103049652-103049674 TGGGACTCCTTGGGAAAAACAGG - Intronic
1031213929 7:118866334-118866356 TGGGAGTTCATTTGAAAAACAGG + Intergenic
1035320601 7:158026991-158027013 TGGCAGTTCCTGGGCCAAAAGGG - Intronic
1039183774 8:34894178-34894200 TGGGACTCCTTGGAAAAAACAGG + Intergenic
1040870829 8:52098871-52098893 TGGTAATCCTTGGGAGAAACAGG + Intergenic
1041730899 8:61061661-61061683 TGGGAGTTCTCTAGATAAACCGG + Intronic
1046381984 8:113463454-113463476 TGCGAGTTCCTGGGATAAAGGGG + Intergenic
1046579019 8:116068557-116068579 TGGGACTCCTTGAGACAAACAGG + Intergenic
1047708063 8:127522661-127522683 TCTGAGTTCTTGAGGCAAACAGG + Intergenic
1048326570 8:133443688-133443710 TGGGAGTTGGTGGGAGAAAGTGG + Intergenic
1049215377 8:141405403-141405425 TGGGTGGTCTTGGGGAAAACTGG - Intronic
1050129376 9:2395654-2395676 TGTGATTTCTTTGGACAACCTGG + Intergenic
1055659445 9:78488029-78488051 TGGGAGTTCATGAGACAGACCGG - Intergenic
1055871306 9:80883813-80883835 TGGGTATTCTTGGGGCAAAAAGG + Intergenic
1056674608 9:88664577-88664599 TGGGATTTGTTGGGAAAGACTGG - Intergenic
1057780672 9:98047458-98047480 TGGGACTCCTTGGGTAAAACAGG + Intergenic
1057941519 9:99289310-99289332 TGGGAGTGCCTGGTACACACAGG - Intergenic
1058355754 9:104081966-104081988 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1186556785 X:10568535-10568557 TGGGAGTTTTTTGGCCAAAAGGG - Intronic
1186615074 X:11177653-11177675 TGGGAGCTCCAGGGATAAACTGG + Intronic
1187397368 X:18930425-18930447 TGGGAGTTCTGAGGAGCAACTGG + Intronic
1188661554 X:32765579-32765601 TAGGAGTTCTTGGCACAGTCTGG + Intronic
1190773471 X:53534116-53534138 TGGAAGTACCTGTGACAAACTGG + Exonic
1191617244 X:63182421-63182443 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1191619054 X:63196502-63196524 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1192077911 X:68018713-68018735 TGGGAGCCCTTGGGACTAAAGGG + Intergenic
1192707740 X:73544586-73544608 TGGAAGTTCTCTGGACAATCAGG + Intergenic
1194131474 X:90087737-90087759 TGGGACTCCATGGGAAAAACAGG - Intergenic
1194379907 X:93178943-93178965 TGGGACTCCTTGGGAAAAATAGG + Intergenic
1197746342 X:129933972-129933994 TGGCAGTTCTGGGGACCAAGAGG - Intergenic
1198181978 X:134219230-134219252 TGGGACTCCTTGAGAAAAACAGG - Intergenic
1199033882 X:143030072-143030094 TGGGAGTTGATGGGGCAAGCTGG + Intronic
1199074544 X:143513208-143513230 TGGGAGTTGATGGGGCAAGCTGG - Intronic
1201645619 Y:16227767-16227789 TTGGGGTTTTTGGGACAGACAGG - Intergenic
1201657194 Y:16357547-16357569 TTGGGGTTTTTGGGACAGACAGG + Intergenic