ID: 952094949

View in Genome Browser
Species Human (GRCh38)
Location 3:29939672-29939694
Sequence ATCTGTGCAGGAAGAGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 514
Summary {0: 1, 1: 0, 2: 4, 3: 59, 4: 450}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952094949 Original CRISPR ATCTGTGCAGGAAGAGAAGA AGG (reversed) Intronic
902961996 1:19970426-19970448 AACAGTGCAGGATGAGATGAGGG - Intergenic
904480624 1:30791219-30791241 CTTTCAGCAGGAAGAGAAGATGG - Intergenic
904505816 1:30952704-30952726 AGGGGTGCAGGAAGAGAGGAGGG + Intronic
904599639 1:31666320-31666342 AGCTATGCTGGAGGAGAAGAGGG - Intronic
905592170 1:39173604-39173626 CTCTGGGCAGGGAGGGAAGAGGG + Intronic
905821838 1:40998702-40998724 AGCTTTTCAGGAAGAGATGAAGG + Intronic
906245566 1:44271081-44271103 TTGTGTGCATGAAGGGAAGAGGG - Intronic
906716655 1:47974737-47974759 ATGTGTGCAGTATGAAAAGATGG + Intronic
907710191 1:56873645-56873667 ATTTGAGCAGCAAGAGAAGTGGG - Intronic
908382652 1:63611405-63611427 AGCATTGCAGGAAGGGAAGAGGG + Intronic
908440562 1:64149665-64149687 AGCTTTGCAGGCAGAGAAGATGG - Intronic
908464820 1:64383034-64383056 ATATGTGCAGTGAAAGAAGAGGG + Intergenic
908882878 1:68752572-68752594 ATCTATACAGGCAGAGAAGCTGG + Intergenic
909503262 1:76358942-76358964 ATCTATTCAGGAAGATCAGAAGG - Intronic
910128083 1:83867943-83867965 ATTTGTGGAAGAAGAGAATAAGG - Exonic
910503069 1:87917025-87917047 ATCTTTGCCTGAGGAGAAGAAGG + Intergenic
910531132 1:88236814-88236836 ATATGTTCGGGAAGAGAGGAGGG - Intergenic
911072068 1:93839995-93840017 ATTTTTGCAGGAAGGGCAGAGGG + Intronic
911567606 1:99482118-99482140 ATGTGTGAAGGAAGAGAATATGG + Intergenic
912244974 1:107952309-107952331 GACAGTGCAGGATGAGAAGAGGG + Intronic
914348288 1:146818301-146818323 ATCTGTCCAGGAAAAGAACTGGG - Intergenic
914980686 1:152411946-152411968 AGCTGTGCAGGCAGAAAAAAAGG - Intronic
915090735 1:153422794-153422816 AACTTTCCAGGAAGAAAAGAGGG + Exonic
915094573 1:153452447-153452469 AACTTTCCAGGAAGAAAAGAGGG - Intergenic
915479150 1:156173357-156173379 GTCTGTGAAGGGAGAGAGGAAGG + Intronic
915729517 1:158043360-158043382 ATCTGAGCAGGAATGGAGGAGGG - Intronic
915733540 1:158070629-158070651 AACAATGCAGTAAGAGAAGAGGG + Intronic
915734272 1:158074918-158074940 AGCTGTGGAGGGAAAGAAGAAGG + Intronic
916158242 1:161879820-161879842 AGGTGTTAAGGAAGAGAAGAGGG - Intronic
917242531 1:172964255-172964277 ATCTGTGCAGCAAACCAAGATGG + Intergenic
917484285 1:175441309-175441331 AATTGTGCAAAAAGAGAAGAGGG + Intronic
917521735 1:175753428-175753450 ATAAGTGCAGGAAGGAAAGATGG + Intergenic
917785221 1:178448088-178448110 ACCAGAGCAGGAAGAGAACAGGG + Intronic
918343424 1:183585784-183585806 ATTTGTGCAGGATGAGAGGGAGG + Intronic
918439628 1:184553861-184553883 ATTTGTTCAGAAAGAAAAGATGG + Intronic
918716670 1:187797625-187797647 ATCAGTGCAGGTAGAAAGGAAGG - Intergenic
919256211 1:195128393-195128415 GTCTGTGAAAGAAGACAAGAGGG - Intergenic
919659856 1:200233895-200233917 ATCTGGGCAGGATGAGAAGCTGG - Intergenic
919802007 1:201359757-201359779 AGCAGTGCAGGAGGAGAAGGAGG + Intronic
920111245 1:203588811-203588833 ATCTGCTCTGGATGAGAAGATGG - Intergenic
921320154 1:213930909-213930931 AGCTGTGTAGGAAGTGTAGAAGG - Intergenic
921398632 1:214695182-214695204 ATATGTGAAGGAAAAGAAGAGGG - Intergenic
921570455 1:216771991-216772013 ATCTGTTTATGAAGAGGAGATGG + Intronic
922063400 1:222113057-222113079 ATCTGTCTACGAAGAGCAGAGGG - Intergenic
923542938 1:234901730-234901752 ATCAGAGCAGGAAGAGAGGTGGG - Intergenic
1062859958 10:803374-803396 ATCTGTTCAGGAAACGAAGGCGG + Intergenic
1062971064 10:1649806-1649828 ATCTATTCAGGCAGAGGAGATGG + Intronic
1064170384 10:13026916-13026938 ATCTGTTCAGGAGGAGGAAATGG - Intronic
1064865910 10:19879717-19879739 AACTGTGAAGGAAGTAAAGATGG + Intronic
1065261180 10:23925259-23925281 ATGTATGCTGAAAGAGAAGAAGG - Intronic
1065293183 10:24251285-24251307 AGCTATGCAGGAAGTTAAGATGG + Intronic
1065375113 10:25031840-25031862 ATCTCTACAGGAAAAGAAAAAGG - Intronic
1066033280 10:31451825-31451847 ATCTGTGGAGGAAGAGAGAAAGG + Intronic
1066129461 10:32378492-32378514 ATTAGTGCAGGCAAAGAAGACGG + Intronic
1066251674 10:33638922-33638944 AGATGTGCAGAAAGAAAAGATGG + Intergenic
1067174213 10:43931068-43931090 ATCTGCCCAGGGAGAGCAGAGGG + Intergenic
1067232256 10:44420063-44420085 CTCTGTGGAGGAGGAGAGGAAGG + Intergenic
1067753791 10:48988722-48988744 ATCTCTGCAAGAGGAGGAGAAGG - Intergenic
1068349380 10:55823218-55823240 ATCTGTCAAGGAAGTGAAAAAGG - Intergenic
1069217324 10:65838482-65838504 ACGTGTGCAGGAAGTGAAGGGGG + Intergenic
1070646571 10:78205971-78205993 AGCTGGGCAGGGAGAGGAGATGG - Intergenic
1071255007 10:83864499-83864521 AACAGTGGAGGAAGGGAAGAGGG - Intergenic
1071676664 10:87661215-87661237 ATTTGAGCAGCAAGAGAACAGGG + Intronic
1072256854 10:93629471-93629493 TTCAGTGAAGGAAGAAAAGAAGG + Intronic
1072464858 10:95653991-95654013 TCCTGTGGAGGAAGAGAATATGG + Intronic
1073333862 10:102689942-102689964 ATCTATAAAGGAAAAGAAGAAGG + Exonic
1073793223 10:106960808-106960830 TTCTGTGCAGGAATGGGAGAGGG + Intronic
1074605844 10:114964680-114964702 ATCCATGCAGGAAGAAAAGGTGG - Intronic
1074881945 10:117666472-117666494 TTCTGTGCAGGGACAGCAGAGGG + Intergenic
1075330148 10:121568118-121568140 ATATGAGAAGGAGGAGAAGACGG + Intronic
1075670431 10:124260638-124260660 ATCTGTGGATGAAGAGTTGATGG - Intergenic
1075867554 10:125739195-125739217 GTTTGTTCAGGAAAAGAAGAAGG - Intronic
1076083580 10:127605747-127605769 ATCAGAGCAGCAAGAGAACATGG - Intergenic
1076517742 10:131058112-131058134 AACAGTCCTGGAAGAGAAGAAGG + Intergenic
1077763532 11:5131848-5131870 GTGTGTGAAGAAAGAGAAGAAGG + Exonic
1077765196 11:5151575-5151597 ATGTGTGAAGAAGGAGAAGAAGG + Exonic
1077842440 11:5990434-5990456 ATCTCTGCCATAAGAGAAGATGG + Intergenic
1078052131 11:7974957-7974979 AGCTTTGCAGGGAGGGAAGAAGG + Intronic
1078067087 11:8085651-8085673 ATGAGGGCAGGAAGAGGAGAAGG + Intronic
1078316541 11:10298020-10298042 ATGGGAGCAGGAAGGGAAGAAGG + Intergenic
1079013249 11:16846942-16846964 AGCTGTGGAAGTAGAGAAGAAGG + Intronic
1079020177 11:16903901-16903923 GTCTCTGAAGGAAGAGAACATGG - Intronic
1080486811 11:32717002-32717024 ATCTGTGGAGGGAAAGAATATGG - Intronic
1081786898 11:45754120-45754142 ACCCCTGCAGGAAGAAAAGAGGG + Intergenic
1081874932 11:46401992-46402014 ATCTGTGCAGGCAGGGAGCAGGG - Intronic
1082204042 11:49409601-49409623 ATCTGTTCAGTAAGAGCAAATGG + Intergenic
1083037519 11:59653640-59653662 CTCTATGAAGGAAGAGAAGCTGG - Intronic
1086404712 11:86489736-86489758 ACCTGTGAAGGGAGAGCAGAAGG - Intronic
1086496054 11:87405575-87405597 ATCTGGGCAGGCTGATAAGAAGG - Intergenic
1086651052 11:89290926-89290948 ATCTGTTCAGTAAGAGCAAATGG - Intronic
1086854881 11:91854335-91854357 ATGTGTGTGGGAAGACAAGAGGG - Intergenic
1088006726 11:104949963-104949985 ATGTCAGCAGGAAGAGAAAATGG - Intronic
1088902631 11:114129595-114129617 TTCTGAGCAGGAAATGAAGAGGG - Intronic
1089183513 11:116598951-116598973 CTCTCAGCAGGAAGAGGAGACGG + Intergenic
1089202245 11:116731562-116731584 AGGTGAGCAGGGAGAGAAGATGG + Intergenic
1089220409 11:116866294-116866316 GGCTGTGGAGGAAGGGAAGAAGG + Intronic
1089989965 11:122850047-122850069 CTCTGTGGAGGAAGAGAAATGGG - Exonic
1090098159 11:123764476-123764498 ATCTGGGCAGGAGGAGGGGAAGG + Intergenic
1090349781 11:126100636-126100658 TTGCATGCAGGAAGAGAAGAAGG - Intergenic
1091022371 11:132112304-132112326 ATGTGTGCAAGAAGAGAACTAGG - Intronic
1091174939 11:133549261-133549283 ATCTGTGCAGAAACAGAACCAGG - Intergenic
1091621316 12:2091513-2091535 CTCTTTGCAGGTAGAGGAGAGGG - Intronic
1091864140 12:3816476-3816498 TTCTTTTCAGGAAGACAAGATGG - Intronic
1092277209 12:7070433-7070455 ATCTGTGCTGGAGGAGAGAAGGG + Exonic
1092346044 12:7715367-7715389 GTCTGTGCAGAGAGAAAAGATGG + Exonic
1093682065 12:22014139-22014161 TTCTGTGGGGGAAGGGAAGAGGG - Intergenic
1094339101 12:29390302-29390324 ACCTGAGAAGGAAGAGAAGAAGG + Intergenic
1094569991 12:31633093-31633115 ATCTGTGCAGGAAAGCAACATGG + Intergenic
1094691782 12:32776476-32776498 AACTAGGCAGGAAGAGAAGGAGG + Intergenic
1095324179 12:40867847-40867869 TTCTGTAAAGGGAGAGAAGATGG + Intronic
1095375299 12:41520078-41520100 CAGTGTGGAGGAAGAGAAGAGGG - Intronic
1096692876 12:53331959-53331981 AACTGTGCAGGAAGAGCAGCAGG - Intronic
1096956356 12:55529963-55529985 CCCTGTGGAGGATGAGAAGATGG - Intergenic
1097005668 12:55915825-55915847 ATTTCTGCAGGCAGAGAAAAGGG + Intronic
1097765504 12:63522031-63522053 CTCTAGGCAGAAAGAGAAGAGGG + Intergenic
1098457837 12:70695586-70695608 ATCTGGGCAGGAAATGGAGAAGG + Intronic
1098581903 12:72109910-72109932 CTCTGTGCAGTCAGAGATGATGG + Intronic
1099298163 12:80857099-80857121 ATGGATGCAGAAAGAGAAGAAGG - Intronic
1099743858 12:86676780-86676802 ATCTGAGCCAGAAGAGAACAAGG + Intronic
1100241647 12:92715541-92715563 ACATGTGGAAGAAGAGAAGAGGG - Intergenic
1100272080 12:93035534-93035556 GTCTGTGCAGAGAGAGAGGATGG + Intergenic
1100650724 12:96585668-96585690 ATCTGGGCAGGATGATAAGAAGG + Intronic
1101326998 12:103724306-103724328 ACCTCTGCAGGAAGAGGTGAAGG + Intronic
1101727042 12:107396291-107396313 TTCAGTGCAGGCAGGGAAGAAGG - Intronic
1101788449 12:107907048-107907070 AGCTGTGAAGAATGAGAAGAGGG + Intergenic
1101898338 12:108772170-108772192 AAGTGGGCAGGGAGAGAAGAGGG + Intergenic
1102446090 12:113003839-113003861 ATCTGTGCAACTAGAGAAGAGGG + Intronic
1102797349 12:115700344-115700366 ATCTGTGTGGGAAGGGCAGAAGG - Intergenic
1103453183 12:121044034-121044056 AGCAGTGCAGGTGGAGAAGAGGG + Intergenic
1103638376 12:122328150-122328172 GTCTCTGCAGGAAAAGAAAATGG - Exonic
1105568306 13:21574084-21574106 AGCTGGTCAGGAAGAGAGGAAGG + Intronic
1106770162 13:32954061-32954083 ATCTTTCCAGGAAGTGAAGGAGG + Intergenic
1107343585 13:39436504-39436526 ATCAGAGCAGGAAGAAAGGAAGG - Intronic
1107690352 13:42947421-42947443 ACCTGAGAAGGAGGAGAAGAAGG - Intronic
1108892844 13:55282700-55282722 ATCAGTACAGGAACAGAAAAAGG - Intergenic
1109533185 13:63680510-63680532 ATATATGCAGGAAGAGAAGTGGG + Intergenic
1109971771 13:69779721-69779743 ATTTATGCTGGAAGTGAAGATGG + Intronic
1110522562 13:76498102-76498124 ATGTGTGCAGAAATAGAGGAAGG + Intergenic
1111535873 13:89602347-89602369 ATGTGTGCAGGAAAAGAATATGG + Intergenic
1111761253 13:92468310-92468332 AGCTGTGCAGGAAGTGAAGTGGG + Intronic
1111896627 13:94150163-94150185 ATTTGTGTAGGAAGGGAAGAGGG - Intronic
1112437179 13:99398994-99399016 ATCTGTGCTGGAAGAACTGATGG + Intergenic
1112579985 13:100670146-100670168 ATCTCAGCAGGAAAAGAACAGGG - Intronic
1112673484 13:101669914-101669936 ACCTCTGCAGGAAGAGAAGGAGG - Intronic
1112933078 13:104765217-104765239 ATATGTTAAGGAAGAGTAGAAGG - Intergenic
1113377834 13:109781868-109781890 TTCTCTGAAGGAAGAGAACAGGG + Intronic
1113907146 13:113824891-113824913 ACCTGTGAAGGGAGAGATGATGG + Intronic
1113986452 13:114320270-114320292 ATGCATGCAGGAAGAGAAGAGGG + Intronic
1114535902 14:23422295-23422317 ATCCCTGGAGCAAGAGAAGAAGG - Exonic
1114636068 14:24187578-24187600 ATCTGTCCAAGAATAGAGGATGG + Exonic
1115376460 14:32682323-32682345 ATCTGTGCAGTGAGAGAGAAGGG + Intronic
1115706391 14:36003202-36003224 ACCTGTGCAGCAAGAGAGGGAGG - Intergenic
1115739353 14:36371680-36371702 GTCTGTGCAGAGAGAAAAGATGG + Intergenic
1115857468 14:37646164-37646186 ATGTGTACAGGATGAGAAAATGG + Intronic
1116323546 14:43500233-43500255 ATCTGTGCAGCAAACGAATATGG + Intergenic
1116506961 14:45695215-45695237 GTCTGTGTAGGAAAAGAAGATGG + Intergenic
1116934154 14:50720695-50720717 ATTTGTGAAGGGAGAGTAGAAGG - Intronic
1117611293 14:57485719-57485741 ACCTGGTAAGGAAGAGAAGAAGG + Intronic
1117695078 14:58353522-58353544 ATCAGTGGAGGAGGAGAAGAAGG - Intronic
1121080956 14:91108034-91108056 ATGAGAGCAGGAAGAGAAAAAGG + Intronic
1121105913 14:91279668-91279690 CTCTGTGCAGTAATAGAGGAGGG - Intronic
1122067853 14:99185946-99185968 ATCTGTGAAGGAAGGGAGGAAGG - Intronic
1122567812 14:102674117-102674139 ATCTGTGCAGGCCTATAAGAAGG + Intronic
1123137797 14:106045540-106045562 TTCCCTGCAGGAAGACAAGAGGG - Intergenic
1123149903 14:106170684-106170706 ATCTCTGCAGGAAGACAGGAGGG - Intergenic
1123173958 14:106400307-106400329 ACCTGGGCAGGAAGGGAAGAGGG - Intergenic
1123182167 14:106481241-106481263 ACCTGGGCAGGAAGGGAAGAGGG - Intergenic
1202944736 14_KI270726v1_random:15489-15511 ACCTGGGCAGGAAGGGAAGAGGG + Intergenic
1124095184 15:26642616-26642638 ATATATGCAGGTAGAGAGGAGGG - Intronic
1124264179 15:28218990-28219012 ATCTTTACAAGAAGAAAAGATGG + Intronic
1125175714 15:36819126-36819148 ATCCTTACAGGAAGAGAAGATGG - Intergenic
1127353183 15:58172888-58172910 ATCTGAGCAGGGAGAGAAGGAGG - Intronic
1127661856 15:61106989-61107011 ATGTGTGTAGGAGGAGAGGAAGG - Intronic
1127932737 15:63607821-63607843 GTGTGTGCAGGAAGAGGGGAAGG - Intergenic
1128721132 15:69949269-69949291 AGCTGTAAAGGAAGAGAAAATGG - Intergenic
1129536369 15:76316418-76316440 CTCTGTGCAGGAAGAGTGGATGG + Intergenic
1129851448 15:78796250-78796272 ATCTGTGCAGGGAAACATGAAGG + Intronic
1130878564 15:88035029-88035051 ATCTGTGCACAAAGAGAAAGAGG + Intronic
1131248354 15:90815024-90815046 CTCTGTGCAGGTTGAGAGGAAGG + Intronic
1131748486 15:95477855-95477877 ATCTGTGAAGAAAGTGAACAAGG + Intergenic
1133143879 16:3769236-3769258 ACCTGTGCTGGAAATGAAGACGG - Exonic
1133555274 16:6900769-6900791 TGCTGTGAAGGAAGAGGAGAGGG - Intronic
1136680151 16:31956108-31956130 ATCTCTGCAGGAAGACAGGAGGG + Intergenic
1136780493 16:32897652-32897674 ATCTCTGCAGGAAGACAGGAGGG + Intergenic
1136889914 16:33961996-33962018 ATCTCTGCAGGAAGACAGGAGGG - Intergenic
1136933822 16:34440515-34440537 CTATGTGCAGGAAAAGAAGAAGG - Intergenic
1136970750 16:34971299-34971321 CTATGTGCAGGAAAAGAAGAAGG + Intergenic
1137236615 16:46623427-46623449 AACTGGGCTGGGAGAGAAGATGG - Intergenic
1138354082 16:56363829-56363851 ATCTGTTTAAAAAGAGAAGACGG + Intronic
1138364748 16:56465527-56465549 ATCTGTGCAGGCTGAGAGGGAGG - Intronic
1138996920 16:62466357-62466379 ACCTGTGGATGAAGAGTAGAAGG - Intergenic
1139326402 16:66155747-66155769 ACCTGTGCAGGACCAGAAGTGGG - Intergenic
1139558614 16:67728107-67728129 GTCTGTGCAGGCTGGGAAGAGGG - Intronic
1139985749 16:70897244-70897266 ATCTGTCCAGGAAAAGAACTGGG + Intronic
1203083120 16_KI270728v1_random:1161618-1161640 ATCTCTGCAGGAAGACAGGAGGG + Intergenic
1142964238 17:3571066-3571088 ATCTGGGCAGGTGGAGAAGAGGG - Intronic
1143590078 17:7879891-7879913 AACTGAGCAGACAGAGAAGAGGG + Intronic
1146375139 17:32288771-32288793 ATCTGTGCAGGAAATGGAGTGGG - Exonic
1146752110 17:35391157-35391179 ACCTGAGAAGGAAGAGAAGAAGG - Intergenic
1147212975 17:38882874-38882896 ATATGTGCAGTCAGAGAAGAGGG - Intronic
1147727587 17:42576146-42576168 AGCTGGCCAGGAAGAGAAGCAGG + Intronic
1148071762 17:44912626-44912648 CTGTGGACAGGAAGAGAAGAAGG - Intronic
1148218600 17:45847375-45847397 ACCTGAGCATGGAGAGAAGATGG - Intergenic
1148763425 17:50021591-50021613 AACAGTGCAGGAGGAGAATAGGG - Intergenic
1148942782 17:51229272-51229294 ATCTGTGTAGCAAAAGAAAAAGG - Intronic
1149649721 17:58269205-58269227 ATTTGAGAAGGAAGAGGAGAGGG + Intergenic
1150049450 17:61946431-61946453 AACTGTGCAAGAAAAGAACAAGG - Exonic
1150226994 17:63529674-63529696 ATCTTTGCAGGATGGGAATATGG + Intronic
1150494513 17:65597024-65597046 ATTTCTGCAGCAAGAGAAAACGG + Intronic
1150590524 17:66558437-66558459 ATCAGTGTAGGGAGAGGAGAGGG + Intronic
1151209438 17:72533370-72533392 ATCTGCACAGGAAGAAAACAGGG + Intergenic
1151433138 17:74078454-74078476 ATCAGAGCAGGTGGAGAAGAAGG + Intergenic
1151778951 17:76229237-76229259 AAGTGTGAAGGAAGAGGAGAGGG - Intronic
1152271002 17:79324834-79324856 CTCTGGGCAGGCAGAGAAGCAGG + Intronic
1153416683 18:4853517-4853539 GTCTGAGGAGGAAGAGAACAAGG + Intergenic
1154077866 18:11223030-11223052 ATCTGTGGAGGAAGACACGCTGG - Intergenic
1155098041 18:22579117-22579139 TTCTGTGAATGAAGTGAAGAGGG + Intergenic
1156089795 18:33453595-33453617 ACCTGTGAAGGGAGAGAAGCAGG + Intergenic
1156121005 18:33842912-33842934 ATCTGTGTAGGAACAAAAGGAGG + Intergenic
1156851836 18:41737599-41737621 ATGTGTGCAGGAAGAAAGGAAGG - Intergenic
1158602936 18:58870559-58870581 TTCTGTGTAGGCAGAAAAGACGG + Intronic
1158818410 18:61130393-61130415 CTCTGTGCAGGGACAGAACAGGG + Intergenic
1159588261 18:70302658-70302680 AGCTGAGTAGGAAGGGAAGAGGG + Intronic
1159994998 18:74955829-74955851 GTGTGTGCAGGGAGAGAGGATGG - Intronic
1160568114 18:79799073-79799095 GTCTCTGCAGGCAGAGAAGGGGG - Intergenic
1162292825 19:9792284-9792306 CTCAGTGAAGGGAGAGAAGAGGG - Intronic
1162292922 19:9792607-9792629 CTCGGTGAGGGAAGAGAAGAGGG - Intronic
1163325906 19:16603127-16603149 GCCTGTGCAGGAGGAGCAGAGGG - Intronic
1164144418 19:22502936-22502958 CTCTGTGCAAGATGAGTAGATGG - Intronic
1166371504 19:42303822-42303844 CTCTGGGGAGGAAGAGGAGAAGG + Intronic
1166783530 19:45354405-45354427 ATCTGTGCTGGAGGATAACAGGG + Intronic
1168269041 19:55239796-55239818 AGGAGTGCAGGAAGAGAAGCTGG + Intronic
1168639324 19:58020280-58020302 ACCTGTGCAGGAAGAGGCCAGGG + Intergenic
1168654481 19:58117652-58117674 ACCTGTGCAGGAAGAGAGGAGGG + Intronic
925004835 2:433982-434004 ATCTGTGGAGCAAGAAAACATGG - Intergenic
925149902 2:1607721-1607743 GTCTGGGCAGGCAGAGAGGAAGG + Intergenic
925201405 2:1970055-1970077 ATTTTGGCAGGAAGAGAATATGG + Intronic
925278570 2:2667728-2667750 CTCTGTGCAGGAAAAGAACTGGG - Intergenic
925947032 2:8874773-8874795 TTCTGTGCAGGAAGGGGAGGAGG - Intronic
925968110 2:9084965-9084987 ACCTGAGCAGGAAGAGATGGTGG + Intergenic
926046076 2:9710607-9710629 GTCTGTGCAGCAACAAAAGAGGG - Intergenic
926137061 2:10343821-10343843 ATGAGGGCAGAAAGAGAAGAGGG + Intronic
926422285 2:12711961-12711983 ATTTGTGTAGGTAGAGAAGAAGG - Intergenic
926506912 2:13727749-13727771 ATTTCTTCAGTAAGAGAAGAAGG - Intergenic
926856315 2:17259989-17260011 ATCTTAGCAGGAATAGACGAAGG - Intergenic
926967899 2:18436076-18436098 ATCAGTGCAGGAGGAGAACTGGG + Intergenic
927028977 2:19100891-19100913 ATCTTTGCAGGGGGAGGAGAGGG - Intergenic
927169919 2:20360710-20360732 TTCTGTCCTGGAAGAGAAGGAGG - Intergenic
928687432 2:33763257-33763279 ATCTATGCAAGAAGAGAGGAGGG + Intergenic
930770160 2:55122574-55122596 ATGTGAGCAGGAAGATAAGCTGG + Intergenic
931804901 2:65794738-65794760 CTCTGTCCAGGAATAGAAGCAGG - Intergenic
931958382 2:67453556-67453578 ATGAGTGCAGAAAGAGAAGAGGG - Intergenic
932176053 2:69603625-69603647 CTCTGTGTAGAAAGATAAGAGGG + Intronic
932369892 2:71178251-71178273 ATCTGGACAGGCAGAGGAGAGGG - Intergenic
932695867 2:73955910-73955932 ATCTGTCCTGGAAGAACAGATGG - Intronic
932805164 2:74777255-74777277 ATCTGAGGAGGAGGACAAGAGGG + Intergenic
934143644 2:89071989-89072011 ATCCGTGGGGGAAGGGAAGATGG + Intergenic
934920001 2:98335391-98335413 AGATGTGAAGGAAGAGAAGGAGG + Intronic
935163407 2:100548757-100548779 TTCAGTTTAGGAAGAGAAGAAGG + Intergenic
935429648 2:102961362-102961384 ATCTCCACAGGGAGAGAAGAGGG + Intergenic
935520307 2:104096414-104096436 ATCTCTGCAAGAAGAGAGGATGG + Intergenic
937226481 2:120373267-120373289 CTCTGGGGAGGGAGAGAAGAAGG + Intergenic
937419288 2:121741091-121741113 ATTCGTGCGGGAAGAGAAGCAGG - Intronic
937429659 2:121827496-121827518 ATCTGTGCAAGTACAGAAGTAGG - Intergenic
938295856 2:130179007-130179029 GTCTGTGGAGGAAGAGAGGCTGG + Intronic
938460760 2:131494818-131494840 GTCTGTGGAGGAAGAGAGGCTGG - Intergenic
938809302 2:134837542-134837564 AGCTGTTCAGGAAGAGGAAAGGG + Intergenic
939857466 2:147377478-147377500 CTATGGGGAGGAAGAGAAGAGGG - Intergenic
940231841 2:151462874-151462896 TTCTGTGCAGGAGGAGCAAATGG + Exonic
941173686 2:162170766-162170788 CTCTGTGAAAGAAGAGAAAAGGG - Exonic
941412448 2:165176391-165176413 AAATGTGCAGGATGAAAAGATGG - Exonic
941485382 2:166073618-166073640 AAATGTGCAGGATGACAAGATGG - Exonic
941597208 2:167492133-167492155 TTCAGTGGAGGGAGAGAAGAGGG - Intergenic
941801542 2:169665156-169665178 ATCTGTACAGGCTGATAAGAAGG - Intronic
942200608 2:173567372-173567394 CTCTGTGCAGGAGGAAAACATGG + Intergenic
942287188 2:174431242-174431264 ATTTCTACAGGTAGAGAAGAGGG - Intergenic
942801622 2:179882717-179882739 ACCAGTGCAGCTAGAGAAGAGGG - Intergenic
944622938 2:201537198-201537220 ATGTGTTGAGGAAGAGATGAAGG - Intronic
945474478 2:210264911-210264933 ATATGGGAAGCAAGAGAAGAAGG + Intergenic
945513621 2:210733751-210733773 TTCATTGAAGGAAGAGAAGAAGG - Intergenic
945865448 2:215169411-215169433 AGCTCTGCAGAAAGAGAGGAAGG + Intergenic
945915259 2:215696976-215696998 ATCTTAGCAGGAGCAGAAGAAGG + Intergenic
946126403 2:217566833-217566855 ATCTGTGGAAGACGAGGAGATGG + Intronic
947086955 2:226464268-226464290 ATCTGAGCATGAAGAAAACATGG - Intergenic
947409317 2:229819104-229819126 ATCTGTGCAGGAAATGAAAGAGG - Intronic
947524329 2:230869206-230869228 ATCAGGGATGGAAGAGAAGAGGG + Intronic
947967543 2:234294202-234294224 AGCTGTGTGGGCAGAGAAGAAGG - Intergenic
948065559 2:235076128-235076150 ATCTTTGCAGGAAAAAAAAATGG - Intergenic
948371514 2:237492627-237492649 ATCTGGGCAGGATGAGCAGTAGG - Intronic
948389403 2:237601261-237601283 CTCTGTGCAGGGTGAGAGGATGG - Intronic
948401018 2:237685529-237685551 TCCTGTGCAGGAAGAGTGGATGG - Intronic
1171103938 20:22413630-22413652 AACTGTGCATGAATAGAAGGAGG - Intergenic
1172391081 20:34565678-34565700 GTGGCTGCAGGAAGAGAAGAGGG - Intronic
1172581129 20:36049903-36049925 ACCTGAGAAGGAAGAGAAGAAGG - Intergenic
1172684692 20:36745106-36745128 AGCTCTGCAGGAAGAAAAAAAGG + Intronic
1173854486 20:46241256-46241278 ATCTGGGTAGGCAGAGAAGAAGG + Exonic
1173873830 20:46357504-46357526 AACAGTGCAGGAAGAGGGGAGGG + Intronic
1173889774 20:46497485-46497507 AGGTGAACAGGAAGAGAAGAGGG + Intergenic
1174819442 20:53713987-53714009 ACCTGTGGAAGAAGAGAAGGAGG - Intergenic
1175473652 20:59253030-59253052 TTGTGGGAAGGAAGAGAAGAAGG + Exonic
1175605842 20:60311637-60311659 GGCTGTGCGGGAAGAGAAGATGG + Intergenic
1176246186 20:64098257-64098279 ATCTCTGCAGGGAGAGAAACGGG - Exonic
1178432138 21:32526090-32526112 TTCTGTACAGGATGAGCAGAAGG - Intergenic
1178846685 21:36179970-36179992 ATCTGTGCAGGCAGAGGAGAGGG - Intronic
1179344151 21:40540467-40540489 ATCTCTGGAGGATGAGAAGCAGG + Intronic
1179577715 21:42318172-42318194 CTCTGTACAGGAACAGAGGATGG + Intergenic
1180033095 21:45225569-45225591 ATCTGTGCACAATGTGAAGACGG - Exonic
1181064100 22:20297609-20297631 ACAAGTGCAAGAAGAGAAGAGGG + Intergenic
1181422547 22:22811807-22811829 ACCTGTGCAGAAAGTGAGGAGGG - Intronic
1181824999 22:25507842-25507864 AATGCTGCAGGAAGAGAAGAGGG + Intergenic
1181855950 22:25781715-25781737 TTGTCTGCAGGGAGAGAAGAGGG - Exonic
1182390000 22:29985529-29985551 GTCTGTGCAGGAAGTGCTGAAGG + Intronic
1182595978 22:31420776-31420798 CTCTGGGCAGGAATGGAAGAGGG + Intronic
1183240237 22:36652413-36652435 ATGTTTGCAGGGTGAGAAGAAGG - Intronic
1183505227 22:38205021-38205043 GGCTGTGCAGGTGGAGAAGAGGG + Intronic
1184208203 22:43018779-43018801 TCCTGTCCAGGAAGAGAGGAGGG + Intergenic
1184278398 22:43423489-43423511 GTCTCTGCAGGTGGAGAAGAGGG + Intronic
949719464 3:6971700-6971722 AACTGTACAGGAAGAAAAAAAGG - Intronic
949791526 3:7797402-7797424 ATCTCTACAGGAGGACAAGATGG + Intergenic
950634520 3:14305435-14305457 ATCTCAGGAGAAAGAGAAGAGGG + Intergenic
952094949 3:29939672-29939694 ATCTGTGCAGGAAGAGAAGAAGG - Intronic
952196145 3:31077340-31077362 ATCTGAATAGGAAGAGATGAAGG - Intergenic
952738075 3:36710080-36710102 ATGAGTCCAGGAAGAGAGGAAGG - Intergenic
952976552 3:38701418-38701440 ATCTGTTCTGGAAAAGGAGATGG - Intronic
953118986 3:40020990-40021012 ATCTGTGGAGGTAGAGAAGAGGG - Intronic
953488087 3:43321817-43321839 ATCTTTGATGGAAGATAAGATGG + Intronic
953516562 3:43598201-43598223 ATCTGTGGAGGAATATAAAAGGG - Intronic
953559884 3:43979336-43979358 TTCTCTGTAGTAAGAGAAGAGGG + Intergenic
953730736 3:45445373-45445395 AGCTGTGGAGGAAAAGATGATGG + Intronic
953748462 3:45592951-45592973 AACTGAGCAGGAAGTAAAGAGGG + Intronic
953921569 3:46955493-46955515 GGCTGTCCAGGGAGAGAAGAGGG + Intronic
954576780 3:51680713-51680735 ATCTGGGGAGGAAGAGGAGCAGG + Intronic
955089798 3:55738536-55738558 ATCTGTGCATGAAGAATGGAAGG - Intronic
955343038 3:58140394-58140416 ACCTGTGCAGGCAGAGGATAGGG + Intronic
955547268 3:60044535-60044557 GACGGTACAGGAAGAGAAGAAGG + Intronic
957652239 3:83022817-83022839 ATCTGAAAAGGATGAGAAGAGGG - Intergenic
959265559 3:104132954-104132976 TTCTGTGTCAGAAGAGAAGAAGG + Intergenic
959700533 3:109294650-109294672 CTCTGTGCAGAAAGGGAAGAAGG - Intronic
959771666 3:110106429-110106451 ATCTGTGAAGGAAAAGTGGAGGG + Intergenic
959961568 3:112303998-112304020 ATCTTTGCAGGCACAGAAGCTGG - Intergenic
960291573 3:115891785-115891807 AAGTGTGATGGAAGAGAAGAGGG - Intronic
961749735 3:129088125-129088147 AACTGGGCTGGGAGAGAAGACGG - Exonic
962107337 3:132404994-132405016 AACAGAGTAGGAAGAGAAGAGGG + Intergenic
962694740 3:137936980-137937002 ATAATTGCAAGAAGAGAAGAGGG + Intergenic
962965681 3:140351971-140351993 TTCTCTACAGGAAGAAAAGATGG - Intronic
963716135 3:148806095-148806117 TTATGTGGGGGAAGAGAAGAGGG - Intronic
964248076 3:154677424-154677446 ATGTCTGTAGGAAGAGAAGCAGG + Intergenic
966319886 3:178690480-178690502 ATCATTGAAGGAAGAGGAGAGGG + Intronic
966488322 3:180497290-180497312 ATCTGTGCAGGAAAAAGAGCAGG + Intergenic
966946610 3:184781244-184781266 GTCTGGGCAGGAAGTGAAGGGGG + Intergenic
967149059 3:186631457-186631479 AGGTGTTCAGAAAGAGAAGATGG + Intergenic
967281596 3:187828764-187828786 ATTAGGGCAGGAAGTGAAGAAGG + Intergenic
967701668 3:192600058-192600080 TTTTGTGTAGGAAGAGAAGCAGG + Intronic
968399937 4:285314-285336 GTGTGTGCAGGGAGATAAGATGG + Intronic
968476422 4:811664-811686 ATGTGTGCCTGAAAAGAAGAAGG + Intronic
968974998 4:3817447-3817469 ATGTGCCCAGGAAGAGAAGGAGG + Intergenic
971163393 4:24157395-24157417 ATGTTTGGAGGAAGAGAAAATGG - Intergenic
972257217 4:37370009-37370031 ATCTGTGCGGGATGTGCAGATGG + Intronic
972522779 4:39876898-39876920 TTCTGTGTAGGAAGATAGGAGGG - Intronic
972723741 4:41727311-41727333 ATCTCTGCGGACAGAGAAGAAGG + Intergenic
974133023 4:57779690-57779712 ATCCAAACAGGAAGAGAAGATGG - Intergenic
975473625 4:74796907-74796929 TTCTGTGTGGGAAGAGAAAAAGG - Intergenic
975877575 4:78861401-78861423 ATCGGTTCAGGAAGAGCTGAAGG - Exonic
979728230 4:123990713-123990735 ATCTGTGGAGGCAGAGATAAGGG + Intergenic
979814931 4:125088414-125088436 ATCTCTGCAGCAACAGAAAACGG - Intergenic
980082942 4:128363532-128363554 GAGTGTGCAAGAAGAGAAGAAGG + Intergenic
980819799 4:137999359-137999381 AACTGGGCAGGATGAGAAAATGG + Intergenic
980996499 4:139784475-139784497 ATCACAGCAGGGAGAGAAGAGGG - Intronic
981242063 4:142489860-142489882 ACCTGAGAAGGAAGATAAGAAGG - Intronic
981710262 4:147701946-147701968 AGATGGGCAGGAAGAGAGGAGGG + Intergenic
982568614 4:157020102-157020124 ATCTCAGTAGCAAGAGAAGATGG - Intergenic
983811606 4:172068979-172069001 ATTTCTGCAGGAGGAGACGAGGG - Intronic
984466303 4:180102929-180102951 ATCTGCTCAGGAAGAAAAAAAGG + Intergenic
985721137 5:1489852-1489874 ATCAGAGCTGGAAGAGAGGAGGG + Exonic
986341233 5:6791106-6791128 ATCAGAGCAGGGAGAGGAGATGG - Intergenic
986415669 5:7525873-7525895 ATCTGTGCATGAGGAGGGGATGG - Intronic
987989234 5:25189972-25189994 ACCTGAGAAGGAAGAGAAGAAGG - Intergenic
988261926 5:28897975-28897997 ATCTGTGCAGAAAGAAAGGGTGG - Intergenic
989271195 5:39535071-39535093 ATCTGTCCTGGGAGAGAAGTGGG + Intergenic
989987428 5:50717581-50717603 ATCTGTGCAAGCAGAGAAAAAGG + Intronic
992073680 5:73171979-73172001 ATCTGTCTAGGAAGGAAAGAAGG + Intergenic
992519450 5:77535263-77535285 TTCTGTGCAGAAGGGGAAGATGG - Intronic
994383031 5:99094327-99094349 AACTGTGTCAGAAGAGAAGAAGG + Intergenic
996236276 5:121134560-121134582 ATGTGTGAAGGTAGTGAAGAGGG - Intergenic
996290791 5:121850923-121850945 ATCTCTGCACTAAGAAAAGATGG + Intergenic
996331569 5:122335585-122335607 ATCTGTGCAGGAAGCTTAGTAGG + Intronic
996612745 5:125403022-125403044 ATCTGTGCAGGGTAAGAACAAGG - Intergenic
997426794 5:133808761-133808783 TTCTGTGCTGGAGGAGAAGATGG + Intergenic
997574457 5:134963314-134963336 TGGTGTGCAGGGAGAGAAGAGGG + Intronic
998531696 5:142890959-142890981 ATCTGCAAAGGCAGAGAAGAAGG - Intronic
999498687 5:152125284-152125306 ATCTTTGAAAGAACAGAAGAGGG - Intergenic
1000335234 5:160237178-160237200 AGGTGTGCAGGAAGAGCATAGGG + Intronic
1001010952 5:168097864-168097886 ATGAGTGAAGGAAGAGAATAGGG - Intronic
1001247775 5:170117951-170117973 ATGTGGGCAGGAGCAGAAGATGG + Intergenic
1001251857 5:170152851-170152873 ATCTGGAGAGGAAGAGAGGAGGG - Intergenic
1001403648 5:171461155-171461177 ATTTGGGAAGGATGAGAAGAAGG - Intergenic
1001459724 5:171900743-171900765 ATCTGTTTAGGAACAGAAAATGG - Intronic
1001588679 5:172850727-172850749 ATAAATGCAGGAAGAAAAGAGGG - Intronic
1001840323 5:174870691-174870713 AACTGGGCAGGGAGAGAAGTAGG - Intergenic
1003269415 6:4593997-4594019 AGCTGGGGTGGAAGAGAAGAGGG - Intergenic
1003278476 6:4672521-4672543 ATCTCTGCAGGAAGAGATTGGGG - Intergenic
1003357348 6:5386185-5386207 AGTTGTACAGGCAGAGAAGAAGG + Intronic
1003981995 6:11398480-11398502 CTCTGTGCAGGAGGTGAAGAAGG + Intergenic
1005722334 6:28615745-28615767 ATCTGAGAAGGACGAGAAGAAGG - Intronic
1005778647 6:29165236-29165258 ACCTGAGAAGGAAAAGAAGAAGG - Intergenic
1006243044 6:32703489-32703511 GTCTTACCAGGAAGAGAAGACGG - Intergenic
1006276952 6:33012163-33012185 ATGTGTGCAGGAAGATATAATGG + Intergenic
1007278119 6:40690503-40690525 ATCTGTGCAGCAGCAGGAGATGG + Intergenic
1007666960 6:43520056-43520078 ATTTGTGCAGGAGATGAAGAAGG + Exonic
1008444936 6:51577441-51577463 ATCAGAGGAAGAAGAGAAGATGG + Intergenic
1009860649 6:69326770-69326792 ATGTGTGGAGGAAGAGGAGAAGG + Intronic
1011697642 6:89926987-89927009 ACCTGGGGAGGAAGAGAAGAGGG + Exonic
1011933240 6:92739739-92739761 ATGTGTCCAGGGAGAGAAAAGGG - Intergenic
1012815255 6:104016074-104016096 CTCTGTGCATGAAGGGAATATGG - Intergenic
1014092466 6:117419479-117419501 ATATTTGTAGGAAAAGAAGAAGG + Intronic
1014451793 6:121590477-121590499 ATCTGTGCAAGAAGGAAAGGAGG + Intergenic
1014724034 6:124954532-124954554 ATATGTGGAGGAAGAGAATTTGG - Intergenic
1016344789 6:143101498-143101520 CTCTGAGCAGGTAGAGATGAAGG + Intronic
1017170695 6:151452016-151452038 CTCTCCGCCGGAAGAGAAGAAGG + Exonic
1017382758 6:153849000-153849022 AATAGTGCAGGAAGTGAAGAAGG - Intergenic
1017601233 6:156083817-156083839 ATCCATTCAGTAAGAGAAGATGG - Intergenic
1017975623 6:159354461-159354483 CTCTGTGCAGGCATAGGAGATGG + Intergenic
1018343535 6:162877775-162877797 TTCTGGGCAGGACAAGAAGAGGG - Intronic
1019219728 6:170464013-170464035 ATCAGGGCAGGAGGAGAAAAGGG + Intergenic
1019362092 7:610075-610097 ATCTGGGCAGGAACAGGTGAAGG - Intronic
1019761116 7:2813619-2813641 ATCTGTGAAGGAAATGAAAATGG + Intronic
1020522356 7:9207559-9207581 ATGTGTGCAGAAGGAGAGGATGG - Intergenic
1021171326 7:17401321-17401343 ATCTCAGCAGGTAGAGTAGATGG + Intergenic
1021179357 7:17487983-17488005 ACCAGTGAAGAAAGAGAAGATGG + Intergenic
1021777713 7:24069949-24069971 AGCTGTACAGGAAGTCAAGAGGG - Intergenic
1022223704 7:28340946-28340968 ATCTGTGCAGAGAGAGAATCTGG - Intronic
1023329041 7:39093892-39093914 ATATGTGCATGAAGAAAATATGG - Intronic
1023878737 7:44306924-44306946 GTGTGAGCAGGAAGAGAAGGGGG + Intronic
1023989789 7:45121882-45121904 ATGTGTACAGGAAGAGAGGAAGG - Intergenic
1025832973 7:65070288-65070310 ATGTGTGCAAAGAGAGAAGAGGG - Intergenic
1025902739 7:65759802-65759824 ATGTGTGCAAAGAGAGAAGAGGG - Intergenic
1028325239 7:89516080-89516102 ATGTGTTCAGAAAGAGAAGGAGG + Intergenic
1028480746 7:91301855-91301877 ATATGGGGAGGAAAAGAAGAAGG - Intergenic
1028513928 7:91655870-91655892 TTCTGTGGAGGGAGAGAGGATGG + Intergenic
1030209992 7:106986657-106986679 CTCTTTGCAGGCAGGGAAGATGG + Intergenic
1031013610 7:116549058-116549080 GTCTGTGCAGGAAAAGAGGCAGG - Intronic
1031018155 7:116597764-116597786 CTCTGTCAAGGAAGAGCAGAAGG + Intergenic
1031200188 7:118672898-118672920 ATCTCTGCAGGAAGCGAAGAAGG + Intergenic
1033830702 7:145248858-145248880 AACTGTACAGGAAGAAAAGTTGG - Intergenic
1034188639 7:149197182-149197204 CTCTGTGCTGGAAGATAAAAGGG + Intronic
1035060665 7:156066983-156067005 GTCTGTGCAGGAAGTAGAGATGG + Intergenic
1035692098 8:1566979-1567001 CTCTGTGGAGGGAGAGGAGATGG - Intronic
1036143479 8:6229481-6229503 ATTTGTGACAGAAGAGAAGATGG - Intergenic
1036665839 8:10737502-10737524 TTCAGTGCAGGTAGAGAAAATGG + Intronic
1036970351 8:13348175-13348197 ATATGTGGAGGGAGAGAAAAAGG + Intronic
1037422329 8:18716312-18716334 ACCTGAGCAGCAAGAGGAGAGGG + Intronic
1037885976 8:22596604-22596626 CTCAGTGCAGGAAGGGAAGAGGG - Intronic
1038066670 8:23970529-23970551 ACCTGTGCAGGCAGAGAATTGGG + Intergenic
1038191569 8:25325871-25325893 GTATGTGCAGGAAGAGATGTTGG + Intronic
1038543667 8:28409451-28409473 ATCAGAGCAGGAAGGAAAGAAGG + Intronic
1039713001 8:40076519-40076541 AGCTGTGGAGGAAGAGAATAGGG + Intergenic
1039849093 8:41346854-41346876 ATCCTTCCAGGAAAAGAAGAGGG + Intergenic
1041255807 8:55978877-55978899 GCCTGTGCAGGCAGAGAACAGGG - Intronic
1042190839 8:66185595-66185617 GTCTTTGTAGGCAGAGAAGATGG - Intergenic
1042868133 8:73373435-73373457 ATCATTGCAGGGAGAGATGATGG - Intergenic
1043135410 8:76517611-76517633 ATCTGTGTGGGAGTAGAAGACGG + Intergenic
1043322160 8:79000982-79001004 ATCAGTGCAGGAGGAGAACATGG + Intergenic
1044035604 8:87299465-87299487 ATGTGAACAGGAGGAGAAGATGG - Intronic
1045986484 8:108255261-108255283 ATCAGTGGAGGTAGAGCAGATGG + Intronic
1046632539 8:116635612-116635634 GACTGTGCAGGAAGAGGACAAGG - Intergenic
1046862162 8:119105781-119105803 ATCACTGCAGGGAGAGAAAAAGG - Exonic
1047182923 8:122606198-122606220 GGCTATGCAGGAAGAGAACATGG + Intergenic
1047460989 8:125065221-125065243 AACTGTGCAGGATGGGAAGTAGG + Intronic
1047517534 8:125568236-125568258 ATCTGTGCAGGAGGAGCAGCTGG + Intergenic
1047537686 8:125734495-125734517 AGCTGAGCAGGAAGAGGGGAAGG - Intergenic
1047729267 8:127713261-127713283 AGCTGTGGAGTAAGAGAACAGGG + Intergenic
1048226704 8:132594686-132594708 GCCTGTGAAGGAAGTGAAGAGGG - Intronic
1048356473 8:133657926-133657948 CTCTCTGCAGGAAGAGCTGAGGG - Intergenic
1048466922 8:134673297-134673319 ATCTGTGCAGAAAGAAAGAATGG + Intronic
1049478918 8:142810769-142810791 AACTGGGCATGAAGAGAACAAGG - Intergenic
1049919679 9:351592-351614 TTCTGTGCAGGTAGAGCAGCAGG + Intronic
1051086489 9:13355478-13355500 ATCTGTGAAGTTAGAGAAGTGGG - Intergenic
1052752055 9:32501814-32501836 ATGAATGAAGGAAGAGAAGAAGG + Intronic
1055508558 9:76971637-76971659 AACTGTGCAGGAAGAGGGTAAGG - Intergenic
1055636750 9:78286693-78286715 ATCTTTGCTGTGAGAGAAGAAGG - Intergenic
1055652400 9:78419214-78419236 ATCTGTATAGGAAGAGGAGTTGG + Intergenic
1055983557 9:82031990-82032012 CTCTGTGCAGGAACTGAAGCTGG - Intergenic
1057079524 9:92162210-92162232 AACAGTCCTGGAAGAGAAGAAGG + Intergenic
1057477112 9:95412120-95412142 ATCTGTGAAGGAAGAGAAAGAGG + Intergenic
1058349167 9:104000270-104000292 ACCTGAGAAGGAAGAGAAGAAGG + Intergenic
1059862561 9:118481216-118481238 ACCTGTGGAAGAAGAGAGGAAGG + Intergenic
1061769489 9:132907358-132907380 ATCTTTTCAGGAAGAGAGAATGG - Exonic
1062196117 9:135275176-135275198 ATCTGTGCAGGCAGACGTGAGGG - Intergenic
1062196306 9:135276103-135276125 AGCTGTCCAGGGAGAGAGGATGG - Intergenic
1062635319 9:137487493-137487515 GTCTGTGCAGGAAAAGAACCGGG + Intronic
1185746761 X:2579655-2579677 TTCTGTGCAAGAAGAGTTGAGGG - Intergenic
1185813309 X:3130498-3130520 ATCTGTGGAGACAGAGAATAAGG + Intergenic
1186108995 X:6236272-6236294 ATATTTGCAGGAAAAGAACAAGG - Intergenic
1189083059 X:37994679-37994701 ATCTGAGGAGGAAGAGGAGGAGG + Intronic
1189220625 X:39368749-39368771 AGATGGGCAGGAAGAGAAAAGGG + Intergenic
1190032096 X:46983642-46983664 ATCTTTGCTGGGAGGGAAGATGG + Intronic
1193397481 X:81003178-81003200 ACCTGAGAAGGAAGAGAAGAAGG - Intergenic
1194009508 X:88542738-88542760 ATCTTTGCAGGGAAAGAAGACGG + Intergenic
1194321715 X:92456702-92456724 ATATGCGCAGGAAGAGGAGGGGG - Intronic
1194673394 X:96764383-96764405 GTGTGTGGAGGCAGAGAAGAAGG + Intronic
1195347086 X:103962000-103962022 GTCTGTGCAGAGAGAAAAGATGG - Intronic
1195360356 X:104076841-104076863 GTCTGTGCAGAGAGAAAAGATGG + Intergenic
1195937264 X:110137663-110137685 ATCAGTGCAGGAAAAGATCATGG - Intronic
1197323188 X:125059201-125059223 ATCTGTACAGTAAGAGAATGGGG - Intergenic
1197355860 X:125436942-125436964 TTCTGTTTAGGAAGAGAAGTGGG + Intergenic
1197416487 X:126180405-126180427 AGCTCAGCAGGAACAGAAGAGGG - Intergenic
1197638925 X:128946969-128946991 GACGGTGCAGGAAGAGAACATGG - Intergenic
1199003648 X:142671044-142671066 ATCTGTGCTTTAAGAGGAGAGGG + Intergenic
1199684996 X:150257851-150257873 AACAGTCCAGGAAGAGGAGAGGG - Intergenic
1199694390 X:150333409-150333431 ATATGTTAAGGAAGAGAACACGG + Intergenic
1200299089 X:154954339-154954361 ATCTGAACATGAAGAGAATAAGG - Intronic
1201268289 Y:12230038-12230060 ATCTGTGGAGACAGAGAATAAGG - Intergenic
1202347654 Y:23950936-23950958 ATCAGAGCAGGAAGAGTAAAGGG + Intergenic
1202523118 Y:25719155-25719177 ATCAGAGCAGGAAGAGTAAAGGG - Intergenic