ID: 952100761

View in Genome Browser
Species Human (GRCh38)
Location 3:30010465-30010487
Sequence GCACTGTTCCAGATTAAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 1, 2: 16, 3: 51, 4: 170}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952100761_952100764 23 Left 952100761 3:30010465-30010487 CCACCTTTAATCTGGAACAGTGC 0: 1
1: 1
2: 16
3: 51
4: 170
Right 952100764 3:30010511-30010533 CAGCTAACAAAAAATGACAGAGG 0: 1
1: 0
2: 2
3: 22
4: 328

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952100761 Original CRISPR GCACTGTTCCAGATTAAAGG TGG (reversed) Intergenic
900182060 1:1315542-1315564 GCCATGTTCCAGATTAAAGTGGG - Exonic
900963675 1:5942611-5942633 GAACTGTTCCAGAATTAAGGAGG + Intronic
901168962 1:7240880-7240902 GCCCTGTTCCTGATTTTAGGGGG - Intronic
901426333 1:9183939-9183961 GCACTGTTCTAGAATCACGGAGG - Intergenic
901618574 1:10562433-10562455 ACATTGTTCCAAATTAAGGGGGG - Intronic
904772770 1:32889805-32889827 GAGCTATTCCAGATTAAAGGGGG - Intronic
906954929 1:50366276-50366298 GAACTGCTACAGATTAAAAGAGG + Intergenic
907036272 1:51219120-51219142 CGACTGTTACAGATTAAAGATGG - Intergenic
911068583 1:93813890-93813912 GAACTGTTCCAGGTTAAAGGAGG - Intronic
911132397 1:94402716-94402738 GAAATGTTCCAGATTAAAGGAGG - Intergenic
911302101 1:96186968-96186990 GCACTGTGCCAAATAAAATGTGG - Intergenic
911549105 1:99258154-99258176 GCAATAATCCAGATTCAAGGTGG - Intergenic
911946764 1:104120443-104120465 TAACTGTCCCAGTTTAAAGGAGG - Intergenic
914697264 1:150096223-150096245 GAACTGCTCCAGATTAAACATGG + Intronic
914777819 1:150754358-150754380 GCACTTTTCCAGGTCAAGGGAGG - Intronic
917045620 1:170856787-170856809 GAACAGTTCCAGATTACATGAGG + Intergenic
918594832 1:186280863-186280885 AAACTGTTCCAGATTTGAGGAGG - Intergenic
921061640 1:211590219-211590241 GAAATGTTCCAGATTAAAGGAGG - Intergenic
921940812 1:220837481-220837503 AAACTGTTCCAAATTAAAGGAGG + Intergenic
922139024 1:222862917-222862939 GTACTGTTCCAGATTAAAGAAGG - Intergenic
923335266 1:232964142-232964164 GAAATGTTCCAAATTAACGGAGG - Intronic
1063350193 10:5347141-5347163 GCACCGCTCCAGAATAAAGTGGG + Intergenic
1063408656 10:5819614-5819636 GTACTGTGGCAGATTAAAGATGG - Intronic
1063847912 10:10151746-10151768 GCACTGTCCCCGACCAAAGGTGG + Intergenic
1065147924 10:22790711-22790733 AAAAAGTTCCAGATTAAAGGAGG - Intergenic
1066055420 10:31676277-31676299 GCACTGTGGTAGATTAAAGATGG - Intergenic
1068982955 10:63080743-63080765 GATTTGTTCCAGATTGAAGGAGG + Intergenic
1069971155 10:72170643-72170665 GAAATGTTCCAGATTCAAGGAGG + Intronic
1070274612 10:74993671-74993693 GTACTATTCCAGATTAAAGGAGG - Intronic
1070409238 10:76124195-76124217 GCAGTGACCCAGATGAAAGGGGG + Intronic
1073241278 10:102060246-102060268 GGAATCTTCCAGAATAAAGGAGG - Intergenic
1075321517 10:121495008-121495030 AGACGGTTCCAGATAAAAGGGGG - Intronic
1077240547 11:1508356-1508378 GCACTGTTCCAGAGCGCAGGGGG - Intergenic
1078181098 11:9011526-9011548 GAAATGTTCCAGATTAAAGGAGG - Intergenic
1081511895 11:43783098-43783120 AGACTGTTCCAGATTGAAGGAGG + Intronic
1083177118 11:60957333-60957355 GCCAAGTTCCAGATGAAAGGCGG - Intergenic
1084902959 11:72323674-72323696 GGACCATTCCAGATTAAAGAAGG + Intronic
1086066579 11:82751504-82751526 GCACTGCTTCAAATTTAAGGTGG - Intergenic
1088756624 11:112890386-112890408 GCACTGTTCCAGAAAACAGAAGG - Intergenic
1089673972 11:120076987-120077009 GGGATGTTTCAGATTAAAGGAGG + Intergenic
1091100806 11:132871678-132871700 GCACTGTTGCAGATGAACAGAGG - Intronic
1092242667 12:6845078-6845100 AAACAGTTCCAGTTTAAAGGTGG - Intronic
1093162029 12:15758580-15758602 GCACTGGTACAGATTAAAGAAGG + Intronic
1093650652 12:21641467-21641489 AAACTGTTCCAGAATGAAGGAGG + Intronic
1094129208 12:27056629-27056651 GGACTGGTCAAGAGTAAAGGAGG - Intronic
1094531118 12:31275998-31276020 GGACTATTCTAGATTAAAAGAGG + Intergenic
1104167168 12:126243613-126243635 GCACTCTTGCAGATGAAAGATGG - Intergenic
1105223594 13:18357489-18357511 GCATTGTTTCAGGTGAAAGGTGG + Intergenic
1106237855 13:27880117-27880139 GGAATGTTTCAGATTAAAGGAGG + Intergenic
1106976633 13:35225494-35225516 TCATTGCTCCAGGTTAAAGGAGG - Intronic
1107854280 13:44599417-44599439 AGATTGTTCCAGATTAAAGAAGG - Intergenic
1108028240 13:46201073-46201095 GAACTGTCCCAGATTAATGGAGG - Intronic
1108078428 13:46707182-46707204 GAAATGTTCCAGATAAAAGAAGG - Intronic
1109108489 13:58286044-58286066 GCACAGTCTCAGATTCAAGGTGG - Intergenic
1109698998 13:66001016-66001038 AAACTGTTCTAGATTAAATGTGG - Intergenic
1110216852 13:73033195-73033217 GAACTATTCTAGATTAAAGAAGG - Intergenic
1110438963 13:75506973-75506995 GAACTGTTCCAGATTAAACAAGG + Intergenic
1111443696 13:88316146-88316168 ACACTGTTGCAGATATAAGGGGG - Intergenic
1111668442 13:91299183-91299205 GAAATGTTTCAGATTAAAGAAGG - Intergenic
1111935605 13:94554071-94554093 GAACTGTTCCATATGCAAGGAGG + Intergenic
1112412346 13:99175378-99175400 GTACTATTCTAGATTAAAAGAGG + Intergenic
1112567908 13:100566916-100566938 GAATTGTTCCAGATGGAAGGAGG - Intronic
1113473391 13:110562207-110562229 TCACTGTTACAGATTAGAGATGG + Intergenic
1115983777 14:39082897-39082919 GAACTGTTCCAGGATGAAGGAGG + Intronic
1116087478 14:40258821-40258843 GCTCTCTGCCAGATTAAGGGAGG + Intergenic
1117262510 14:54050683-54050705 ACAATGTTCCAGACTAAAAGGGG + Intergenic
1118182052 14:63503531-63503553 CAACTGTTCCAGAGCAAAGGAGG + Intronic
1118306683 14:64660908-64660930 GAACTGTTCTAGATTGAGGGAGG + Intergenic
1120141361 14:80933217-80933239 ACACTGTTCCTAATTAAAGGCGG - Intronic
1122147712 14:99702962-99702984 GAACTGTTCTAGAATAAAGGGGG - Intronic
1125643947 15:41255233-41255255 GGATTGTTCCAGATCAAGGGGGG - Intronic
1125644271 15:41258500-41258522 GAAATGTTCCAGATTAAAGGAGG - Intronic
1126446387 15:48749753-48749775 GAAATGTTCTAGATTAAAGGAGG + Intronic
1131655957 15:94459140-94459162 ACACAATTCTAGATTAAAGGGGG - Intronic
1134033416 16:11010794-11010816 GAAATGTTCCGGAGTAAAGGAGG - Intronic
1138573055 16:57888144-57888166 ACACAGCTCCAGCTTAAAGGAGG - Intronic
1139792121 16:69446805-69446827 AAACTGTTCCAGATTGAAGGAGG - Intronic
1141732612 16:85833118-85833140 GGACTGTTCCAGACAACAGGAGG - Intergenic
1142819417 17:2453344-2453366 GAACTATTCCAGATTGAAGGAGG - Intronic
1144996250 17:19271226-19271248 GCTCTGTTCCAGATGACAGCTGG + Intronic
1146703725 17:34984252-34984274 GAAATATTTCAGATTAAAGGAGG - Intronic
1152670416 17:81601011-81601033 GCCCTGTGCCAGATGAAAGGAGG - Intronic
1155481268 18:26290383-26290405 GCAGTCTTCCTGAGTAAAGGAGG + Intronic
1158059477 18:53321176-53321198 GCACTATTTCAGATGAATGGGGG + Intronic
1158497826 18:57972661-57972683 GAAATGCTCCAGACTAAAGGAGG - Intergenic
1161733294 19:5975559-5975581 GCACCGTTCTAGATGCAAGGGGG + Intronic
1162221542 19:9181416-9181438 GAAATGTTCCAGATTAAAGGAGG - Intergenic
1164924182 19:32113995-32114017 TAACTGTTCCAGATTAACGATGG + Intergenic
1165801029 19:38550283-38550305 GCACAGTTCCAGACTGAAGGAGG - Intronic
1167651271 19:50730733-50730755 GAAATGTTCCAGATTCAAGGAGG - Intergenic
1168490643 19:56805766-56805788 GAGGTTTTCCAGATTAAAGGAGG + Intronic
925528603 2:4833881-4833903 TCAGTGTACCAGATTCAAGGTGG - Intergenic
928076631 2:28271146-28271168 GCAGTGTTTGAGATAAAAGGAGG + Intronic
928533875 2:32220203-32220225 GCACTGATCCAGCCTAAAAGGGG - Exonic
929376932 2:41298931-41298953 GCACTGTTCTAGACTGATGGTGG + Intergenic
929472307 2:42206556-42206578 GTTCAGTTCCAGATTAAAGTAGG - Intronic
929761146 2:44807694-44807716 TCACAGTTCCAGATTCAAGGTGG - Intergenic
930371267 2:50504099-50504121 GAAATGTTCTAGATTAAAGGAGG + Intronic
930726264 2:54684786-54684808 GAACTGTTCCAGATGAAAGGAGG + Intergenic
930790746 2:55325594-55325616 GTATTCTTCCTGATTAAAGGGGG + Intronic
930975469 2:57454113-57454135 GCACTATTCCAGAATGCAGGGGG + Intergenic
931169355 2:59786479-59786501 CCACTGTTACACAGTAAAGGGGG + Intergenic
931836173 2:66100265-66100287 CCACTGCTCTAGATTAAAAGAGG - Intergenic
932402787 2:71493340-71493362 GAAACGTTCCAGATTAAAGGAGG - Intronic
933790157 2:85877354-85877376 GAACGGTTTCAGATTAAAGAAGG - Intronic
935012438 2:99148078-99148100 GAACTGTTTCAGATTAAAGGAGG - Intronic
935569253 2:104641892-104641914 CCACTGTTCCAGACTCATGGTGG - Intergenic
935933874 2:108159912-108159934 GAAATGTTCCAGATAAAAGAAGG + Intergenic
936461510 2:112717819-112717841 GAAATGTTCCAGATTACAGGAGG - Intergenic
938714261 2:134004892-134004914 AAAAAGTTCCAGATTAAAGGAGG + Intergenic
940673379 2:156698203-156698225 GAGCTGTTCTAGATTAAAGCAGG - Intergenic
940721961 2:157292242-157292264 GCACTGTTCCTGATTCAGAGAGG - Intronic
941590959 2:167419783-167419805 GGACTGTTTCTGAATAAAGGTGG - Intergenic
944785354 2:203064689-203064711 GAAATGTTTCAGATTAAAAGAGG + Intronic
1168775326 20:442478-442500 GAACTGTTCCAGATTAAAAATGG + Intronic
1169750186 20:8984196-8984218 GCAGTGTTCCAGATCAAAGGAGG - Intergenic
1170408455 20:16063960-16063982 GAACTGTCCCAGATTAAAGGAGG + Intergenic
1170722796 20:18898741-18898763 GTACTGTTCCTGATTGCAGGAGG - Intergenic
1171026102 20:21632018-21632040 GAACTGTTCTAGAATAGAGGAGG - Intergenic
1171038057 20:21732776-21732798 GAACTGTTCCAGATGAAAGGAGG - Intergenic
1172067609 20:32232887-32232909 GCACTGGACCAGCTTAATGGAGG - Intronic
1173247122 20:41344612-41344634 GCACTGTGCCAGCTTGGAGGAGG + Intronic
1174334504 20:49849362-49849384 GCAGTGTTTCAGATGAAAGATGG + Intronic
1175398738 20:58686755-58686777 GGACTGTTCTGGATTAAAGGAGG + Intronic
1176732137 21:10509870-10509892 GCATTGTTTCAGGTGAAAGGTGG + Intergenic
1177460349 21:21400859-21400881 GCACTAGTCCATATAAAAGGTGG - Intronic
1178613282 21:34106878-34106900 GAAGTAGTCCAGATTAAAGGGGG - Intronic
1179084011 21:38201289-38201311 GTACTCATCCAGATTAAGGGTGG - Intronic
1179216259 21:39369612-39369634 GAAATGTTTCAGATTAAAGGAGG + Intergenic
1182390334 22:29989197-29989219 AAAATGTTCCAGATTAAAGAAGG - Intronic
1182701498 22:32243316-32243338 GAAATGTTCCAGATGAAAGGAGG + Intronic
1183198543 22:36370036-36370058 GCACTGTGCCAGATAAATTGTGG + Intronic
950107297 3:10396419-10396441 GCACTGTTTCAGCTTAGAAGAGG - Intronic
950758990 3:15203570-15203592 ACAGTGTTCCAGAAGAAAGGTGG - Intergenic
952100761 3:30010465-30010487 GCACTGTTCCAGATTAAAGGTGG - Intergenic
952273509 3:31855339-31855361 GAAGTGTTCCAGATTAAATGAGG - Intronic
952952391 3:38535515-38535537 GAACTCTCCCAGATTAAAGGAGG - Intronic
953593483 3:44284055-44284077 GAAATGTTCTAGATTAAAGGAGG - Intronic
953661161 3:44892763-44892785 AAATTGTTCCAGATTAAAGGAGG - Intronic
955237597 3:57153483-57153505 GAACTGTTCTGTATTAAAGGAGG + Intronic
956344934 3:68268284-68268306 GCACCATTTCAGTTTAAAGGAGG + Intronic
959558998 3:107758183-107758205 GCACTGTTAAAGATTGAGGGAGG + Intronic
961583182 3:127900231-127900253 GAACTGTTCCTGATGAAAGAAGG + Intergenic
964465760 3:156990077-156990099 GAAATATTCTAGATTAAAGGAGG - Intronic
965068571 3:163885739-163885761 TAACTGTTCCAGATTAAAGTAGG - Intergenic
965586869 3:170326732-170326754 GTACTGGTCCAGATTAACGCAGG - Intergenic
965782244 3:172298047-172298069 GAATTGTTCCAAATTAAAGAAGG - Intronic
968484997 4:855641-855663 GCCCTGTTCCTGATTTTAGGAGG + Intronic
972583963 4:40419690-40419712 GCACTGTTCAACATTAAATAGGG - Intergenic
973928410 4:55764272-55764294 GCACTGTTACTGAGGAAAGGGGG + Intergenic
975146828 4:70977236-70977258 GCACATTTCCAGATCAAAGGAGG - Intronic
976408062 4:84681717-84681739 CCACTGTTCTACATCAAAGGGGG + Intronic
976428879 4:84939105-84939127 GAAGTGTTCCAAATTAAAGGAGG - Intronic
978008084 4:103643323-103643345 GCACTGTTCTAGAGTAAATCAGG + Intronic
978713643 4:111815592-111815614 ACAGTGTTCCAAGTTAAAGGTGG - Intergenic
980948124 4:139343475-139343497 AAACTGTTTCAGATTAAAAGAGG - Intronic
986625372 5:9718918-9718940 GAATTGTTCTAGATTAAAGTAGG + Intergenic
988649972 5:33138342-33138364 GCACTGTGCCAACTTCAAGGGGG + Intergenic
992913465 5:81422421-81422443 GCACTGTTCCTGAGGAAAGGTGG + Intronic
994076327 5:95653950-95653972 GGACTTTTCAAGATTAATGGAGG - Intronic
995446769 5:112253438-112253460 AAAGTGTTCCAGATTAAAGGAGG + Intronic
996511902 5:124325894-124325916 GGACTGTTCCAGATTAAAAGTGG + Intergenic
997117771 5:131144385-131144407 GAACTGTTCTAGATTAAAAGAGG - Intergenic
998195775 5:140069455-140069477 GAAATGTTCCAGATTTAAGGTGG + Intergenic
998305986 5:141077682-141077704 GAAATGTTCCAGCCTAAAGGGGG + Intergenic
999068637 5:148718408-148718430 GTTCTGTACCATATTAAAGGTGG - Intergenic
1000832029 5:166114461-166114483 GAAATGCTCCAGGTTAAAGGAGG - Intergenic
1002669470 5:180854842-180854864 CAAATGTTCCAGATTAAAGAAGG + Intronic
1003041289 6:2689986-2690008 TCACTGTTTCAGATTAATAGAGG + Intronic
1003789581 6:9528630-9528652 GAACTATTCCAAATTGAAGGAGG + Intergenic
1003956289 6:11168443-11168465 GGAATGTTTCTGATTAAAGGAGG - Intergenic
1005150886 6:22749117-22749139 GCACTGCCCCACATTCAAGGTGG - Intergenic
1005851562 6:29827282-29827304 CAACTTTTCCAGATTTAAGGGGG + Intronic
1007521201 6:42452694-42452716 GCACTGGTCCGGGTTTAAGGCGG - Intergenic
1008279547 6:49579475-49579497 GAATTGTTCTAGATTAAAGGAGG + Intergenic
1010740509 6:79497587-79497609 GAAATGGTCCAGATAAAAGGAGG + Intronic
1012286437 6:97395229-97395251 GGACAGTTCTAGATTAAACGAGG - Intergenic
1012426930 6:99124958-99124980 GAAATGCTCCAGATTAAAGGAGG + Intergenic
1014317161 6:119882375-119882397 GACTGGTTCCAGATTAAAGGAGG - Intergenic
1014764893 6:125395043-125395065 GCAATGTTCAAGATTTGAGGAGG + Intergenic
1014822864 6:126012531-126012553 GAAGTGTTACAAATTAAAGGAGG - Intronic
1017202287 6:151768405-151768427 GAACAGTTCCAGACCAAAGGAGG + Intronic
1017348958 6:153417412-153417434 CCACTGTTCCACCCTAAAGGTGG - Intergenic
1017655232 6:156621164-156621186 GAACTGTTGCAAATTAAAGGAGG + Intergenic
1017993949 6:159514648-159514670 GAACCGTTCCAGATTAGAAGAGG + Intergenic
1021855723 7:24853483-24853505 GAACTGTTCCCAATTAAAGGAGG + Intronic
1022793253 7:33710788-33710810 CCACTGTACCAGAATCAAGGTGG + Intergenic
1023685317 7:42728188-42728210 GCTCTGTTCCAGGCTATAGGAGG - Intergenic
1024563760 7:50665171-50665193 GCACTCTCCCAGAGCAAAGGGGG + Intronic
1024997777 7:55286977-55286999 CCACTCTTCCAGAGTTAAGGTGG - Intergenic
1026181667 7:68046747-68046769 GCACTGTTTCTGAGAAAAGGAGG - Intergenic
1026774399 7:73222318-73222340 AGACTGATCCAGATTAAAGAAGG - Intergenic
1027015256 7:74775704-74775726 AGACTGATCCAGATTAAAGAAGG - Intronic
1027072775 7:75170249-75170271 AGACTGATCCAGATTAAAGAAGG + Intergenic
1027781474 7:82525865-82525887 GAACTCTTCCATACTAAAGGAGG + Intergenic
1030671578 7:112344032-112344054 AAACTATTTCAGATTAAAGGTGG + Intergenic
1034597446 7:152211534-152211556 GCATTGTTTCAGGTGAAAGGTGG - Intronic
1035468502 7:159095099-159095121 GGAGAGTTCCAGATTAAAGCCGG + Intronic
1036036788 8:5028726-5028748 GCACTGGACCAGGTTAAAAGTGG + Intergenic
1037572357 8:20169250-20169272 GAACTTTTCCAGATTAAAAGAGG + Intronic
1038254046 8:25934422-25934444 GCAGTGTTTCAGAATAAATGAGG - Intronic
1039243016 8:35577330-35577352 GAACTTATCCAGATTAAAGAAGG - Intronic
1043571871 8:81613146-81613168 GAAATGTTCCAGATCAAAGGAGG + Intergenic
1043577104 8:81670619-81670641 GAAATGTTCCAGATCAAAGAAGG + Intronic
1044708738 8:95034494-95034516 GAAATGTTCCAGAATAAAGGAGG - Intronic
1046734233 8:117759220-117759242 GAAATGTTTCAGATAAAAGGAGG + Intergenic
1046952643 8:120032809-120032831 GCACAGTTCCAGATTCAAGTTGG - Intronic
1047221662 8:122923599-122923621 ACACTGTGGCAGATTAAAGGTGG - Intronic
1047363056 8:124186634-124186656 GAACTATTCAAGATGAAAGGAGG + Intergenic
1047596665 8:126384904-126384926 AAACTGTTGTAGATTAAAGGAGG + Intergenic
1048072663 8:131039250-131039272 GCACTGTGCCAGACTGAAGGCGG + Intronic
1048491585 8:134898758-134898780 GAAGTGTCTCAGATTAAAGGAGG - Intergenic
1049113224 8:140662935-140662957 GAGCTGTTTCAGATGAAAGGAGG + Intronic
1051161540 9:14213933-14213955 CCACTGCTCCAAATTTAAGGGGG + Intronic
1051263234 9:15286273-15286295 AAAATGTTTCAGATTAAAGGAGG - Intronic
1056096618 9:83261173-83261195 GCAGTGTTCCAGATTTCAGCTGG - Intronic
1056372458 9:85970755-85970777 GAAATGCTCCAGATTAAAGGAGG + Intronic
1057434946 9:95031600-95031622 ACACTTTTGCAGATCAAAGGGGG + Intronic
1059136144 9:111808363-111808385 CCCCTGTTCCATATTGAAGGAGG + Intergenic
1059931672 9:119267023-119267045 GCAGTGATCCAGATAAAAGCAGG + Intronic
1060227393 9:121801888-121801910 AAAATGTTCCAGATTAAAAGAGG - Intergenic
1060429008 9:123532408-123532430 GAACTATTCTAGATTAAAGGAGG - Intronic
1060540429 9:124426367-124426389 GGATTGTTCCAGGTTGAAGGAGG - Intergenic
1062275578 9:135728812-135728834 GAGCTGTTCCAGATTAAAAAGGG - Intronic
1187158210 X:16740895-16740917 GGAATGTTCCTGATTAAAGAAGG - Intronic
1187552536 X:20320498-20320520 GAAATGTTCCAGATTAAAGGAGG - Intergenic
1187861609 X:23688908-23688930 GCACTGCTCCAGATTATGGTAGG - Intergenic
1189009601 X:37034003-37034025 GAACTAGTCCATATTAAAGGAGG - Intergenic
1190386182 X:49884224-49884246 GAAATGTTCCAGATTAAAGGAGG - Intergenic
1191895171 X:65985078-65985100 GCCCTGTTCCAGATGACATGGGG + Intergenic
1193698719 X:84739302-84739324 GAACTTCTCCAGAATAAAGGAGG - Intergenic
1194695804 X:97048274-97048296 GAAATGTTCCACATTAAATGAGG - Intronic
1194738979 X:97549745-97549767 GAACTGTTCCAGATTAAAGGAGG - Intronic
1195798347 X:108678889-108678911 GAACTGTTTCAGATTAAAGAAGG - Intronic
1195977763 X:110546185-110546207 AAACTGTTCCAGAGTAAAGAAGG - Intergenic
1196198674 X:112861390-112861412 GAAATGTTCCAGATAAAATGGGG + Intergenic
1196940139 X:120767706-120767728 GAAATGTTCCAGATTAAAAGAGG - Intergenic
1197186694 X:123595327-123595349 GAACTGCTACAGATTAAAGAAGG + Intergenic
1198399268 X:136253492-136253514 GAAGTGTTCCAGATCACAGGAGG + Intronic